View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_60 (Length: 213)
Name: NF2085_1D_low_60
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 41 - 208
Target Start/End: Original strand, 18948082 - 18948249
Alignment:
| Q |
41 |
ccttggtggcggcgccggcgaaagggagatggaggggcggtgtttttatgagatgaagaagaaatgcgtgttgtaacataggaggaaaagaggataggcg |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18948082 |
ccttggtggcggcgccggcgaaagggagatggaggggcggtgtttttatgagatgaagaagaaatgcgtgttgtaacattggaggaaaagaggataggcg |
18948181 |
T |
|
| Q |
141 |
tgtgtttttatttttcagtaaagaaatgctttttctaagccttttaatctcagccattagtattatat |
208 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
18948182 |
tgtgtttttgtttttcagtaaagaaatgttttttctaagccttttaatctcagccattaattttatat |
18948249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 142 - 208
Target Start/End: Complemental strand, 18947425 - 18947359
Alignment:
| Q |
142 |
gtgtttttatttttcagtaaagaaatgctttttctaagccttttaatctcagccattagtattatat |
208 |
Q |
| |
|
|||| |||||||| | ||||| |||||||||||||||||||| |||||||| ||||| || |||||| |
|
|
| T |
18947425 |
gtgtgtttattttccggtaaataaatgctttttctaagccttctaatctcaaccattggttttatat |
18947359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 2581259 - 2581210
Alignment:
| Q |
149 |
tatttttcagtaaagaaatgctttttctaagccttttaatctcagccatt |
198 |
Q |
| |
|
|||||| ||||||| ||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
2581259 |
tattttccagtaaacaaatgctttttttaagctttttaatctcaaccatt |
2581210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 138 - 199
Target Start/End: Original strand, 30146989 - 30147050
Alignment:
| Q |
138 |
gcgtgtgtttttatttttcagtaaagaaatgctttttctaagccttttaatctcagccatta |
199 |
Q |
| |
|
||||||| |||| |||||| ||||||| || |||| |||| |||||||||||||||||||| |
|
|
| T |
30146989 |
gcgtgtgcttttttttttctttaaagaattgtttttcctaaaccttttaatctcagccatta |
30147050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University