View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_61 (Length: 213)
Name: NF2085_1D_low_61
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_61 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 68 - 213
Target Start/End: Complemental strand, 12552231 - 12552084
Alignment:
| Q |
68 |
aaaattgacgtct--aacacttagtgatggaattagagacgaaattattttttccgtctgtgaaattccgtcgctatctttagagtgatttcaatatcat |
165 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12552231 |
aaaattgacgtctctaacacttagtgatggaattagagacgaaattattttttccgtctctgaaattccgtcgctatctttagagtgatttcaatatcat |
12552132 |
T |
 |
| Q |
166 |
tttctacataagaaaaaacaagttgagaaatatacttgtttccaagaa |
213 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
12552131 |
tttctacataagaaaaaacaagataagaaatatacttgtttccaagaa |
12552084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University