View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_63 (Length: 209)
Name: NF2085_1D_low_63
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_63 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 24 - 209
Target Start/End: Original strand, 6963109 - 6963294
Alignment:
| Q |
24 |
cgtcgttcttggacccaaagggaagaggtgcttcaactggttatgacaatgcagttgcattgcctgctggtggaagaggcgatgaggaagaacttggtaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6963109 |
cgtcgttcttggacccaaagggaagaggtgcctcaactggttatgacaatgcagttgcattgcctgctggtggaagaggcgatgaggaagaacttggtaa |
6963208 |
T |
|
| Q |
124 |
ggaaaataacaagagtgctgcatcatctaaagggaaaattacattgagtgtaactcagagtaagcctgaaactggtgaggttattg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6963209 |
ggaaaataacaagagtgctgcatcatctaaagggaaaattacattgagtgtaactcagagtaagcctgaaactggtgaggttattg |
6963294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 29 - 209
Target Start/End: Complemental strand, 33606196 - 33606016
Alignment:
| Q |
29 |
ttcttggacccaaagggaagaggtgcttcaactggttatgacaatgcagttgcattgcctgctggtggaagaggcgatgaggaagaacttggtaaggaaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||| || || |||||||||||||||||||||||||| ||||| |||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
33606196 |
ttcttggacccaaagggaagaggtgcatctaccggttatgacaatgcagttgcattgccagctggaggaagaggagatgaagaagaacttggaaaggaaa |
33606097 |
T |
|
| Q |
129 |
ataacaagagtgctgcatcatctaaagggaaaattacattgagtgtaactcagagtaagcctgaaactggtgaggttattg |
209 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||| ||||||||||| ||||| | ||||||||| |||||||| ||||||| |
|
|
| T |
33606096 |
acaacaagagtgctgcatcatctaaggggaaaatcacattgagtgttactcaaactaagcctgagactggtgaagttattg |
33606016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University