View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_66 (Length: 207)
Name: NF2085_1D_low_66
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 173
Target Start/End: Complemental strand, 18996834 - 18996673
Alignment:
| Q |
12 |
gatttattatctacatttagccctaaccataagatcatcaacacaaataacctaacaaccactcattgctttccatccgcgatcgtagggctgataaagc |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18996834 |
gatttattatctgcatttagccctaaccataagatcatcaacacaaataacctaacaaccactcattgctttccatccgcgatcgtagggctgataaagc |
18996735 |
T |
|
| Q |
112 |
atggataaatgatcatagaccctaaattgctaccaaaccctaaaacccttcttgatgtccat |
173 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18996734 |
atggacaaatgatcatagaccctaaattgctaccaaaccctaaaacccttcttgatttccat |
18996673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 25 - 167
Target Start/End: Complemental strand, 18991765 - 18991623
Alignment:
| Q |
25 |
catttagccctaaccataagatcatcaacacaaataacctaacaaccactcattgctttccatccgcgatcgtagggctgataaagcatggataaatgat |
124 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||||||||||| ||||||| |||||||| ||| | |||||| ||||||||||||| | | | |
|
|
| T |
18991765 |
catttagtcctaatcacaagatcatcaacacaaataacctaacaaccgctcattgttttccatcagcggttgtagggttgataaagcatggcccagtaac |
18991666 |
T |
|
| Q |
125 |
catagaccctaaattgctaccaaaccctaaaacccttcttgat |
167 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18991665 |
cataaaccctaaattgctaccaaaccctaaaaccctacttgat |
18991623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University