View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_70 (Length: 205)
Name: NF2085_1D_low_70
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_70 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 24494598 - 24494766
Alignment:
| Q |
17 |
catcatctacacactttacatccttgaaaagacttcttcgatatcacaaagccaccatgtttcatggacttcacttgaagcacacttcttctcaaaatct |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24494598 |
catcatctacacactttacagccttgaaaagacttctttgatatctcaaagccaccatgtttcatggacttcacttgaagcacacttcttctcaaaatct |
24494697 |
T |
|
| Q |
117 |
ttatgcattcagtgatgccgattgggctggaaatagagatgattatacatccacctctgcacatgttac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24494698 |
ttatgcattcagtgatgccgattgggctggaaatagagatgattatacatccacctctgcacatgttac |
24494766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 93948 - 94116
Alignment:
| Q |
17 |
catcatctacacactttacatccttgaaaagacttcttcgatatcacaaagccaccatgtttcatggacttcacttgaagcacacttcttctcaaaatct |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
93948 |
catcatctacacactttacaaccttgaaaagacttcttcgatatctcaaagccaccatgtttcatggacttcacttgaagtgcacttcttctcaaaatct |
94047 |
T |
|
| Q |
117 |
ttatgcattcagtgatgccgattgggctggaaatagagatgattatacatccacctctgcacatgttac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
94048 |
atatgcattcagtgatgccgattgggctggaaatcgagatgattatacatccacctctgcacatgttac |
94116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University