View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_73 (Length: 201)
Name: NF2085_1D_low_73
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 23029094 - 23029163
Alignment:
| Q |
19 |
ccttcacaaaatctttctctcac----acacattattcaaatatacatcgatttataaacctttcctcca |
84 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23029094 |
ccttcacaaaatctttctctctctctcacacattattcaaatatacatcgatttataaacctctcctcca |
23029163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University