View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2085_1D_low_73 (Length: 201)

Name: NF2085_1D_low_73
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2085_1D_low_73
NF2085_1D_low_73
[»] chr1 (1 HSPs)
chr1 (19-84)||(23029094-23029163)


Alignment Details
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 23029094 - 23029163
Alignment:
19 ccttcacaaaatctttctctcac----acacattattcaaatatacatcgatttataaacctttcctcca 84  Q
    ||||||||||||||||||||| |    ||||||||||||||||||||||||||||||||||| |||||||    
23029094 ccttcacaaaatctttctctctctctcacacattattcaaatatacatcgatttataaacctctcctcca 23029163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University