View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_2D_high_10 (Length: 203)
Name: NF2085_2D_high_10
Description: NF2085_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_2D_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 60 - 186
Target Start/End: Original strand, 38881881 - 38882005
Alignment:
| Q |
60 |
atatgcgggtggaatattttgtttgttgtgataagcttaaactcacatttatttcttgcatgtgtttttagttccttataaattgttgctactcccctcc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
38881881 |
atatgcgggtggaatattttgtttgttgtggtaagct-aaactcacatttatttcttgcatgtgtttttagttccttataaattgttgccact-ccctcc |
38881978 |
T |
 |
| Q |
160 |
atctatttcgctcactcacacattaac |
186 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
38881979 |
atctatttcgctcactaacacattaac |
38882005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 38881880 - 38881815
Alignment:
| Q |
1 |
acttccttctaatgcggtgttcagttagcctagtaaaccgactcaaagtaatatataccatatgcg |
66 |
Q |
| |
|
||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38881880 |
acttccttctaatgcggtgttcagttaaccaagtgaaccgactcaaagtaatatataccatatgcg |
38881815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University