View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_2D_high_2 (Length: 756)
Name: NF2085_2D_high_2
Description: NF2085_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_2D_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-171; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 1 - 433
Target Start/End: Complemental strand, 38014695 - 38014260
Alignment:
| Q |
1 |
cctgcttgcttccctgtttatgtttttatttgctttgtttgcagcttgagaaaggagagaatttcgttgatgtgcttaacccttgcacaaaaaaggagac |
100 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38014695 |
cctgcttgcttccctgtttaagtttatatttgctttgtttgcagcttgaggaaggagaggatttcactgatgtgcttaacccttgcacaaaaaaggagac |
38014596 |
T |
 |
| Q |
101 |
tctagcatatggagactccaatatgcaaaatcttaagcgtggagaagtattacagctggagagaaagggatatttcaggtgtgatgtacccttcgtctgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
38014595 |
tctagcatatggagactccaatatgcgaaatcttaagcgtggagaagtattgcagctggagagaaagggatattttaggtgtgatgtacccttcgtccgg |
38014496 |
T |
 |
| Q |
201 |
ccttcggaaccaaccgtgttatttgcaatcccagatggcaggcagcagacatctttgaagtaaaaaac---ttttgnnnnnnnaatgacaagttggtaat |
297 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||| ||||||||| |
|
|
| T |
38014495 |
ccttcgaaaccaatcgtgttatttgcaatcccagatggcaggcagcagacatctttgaagtaaaaatcttttttttgtttttgaatgacaggttggtaat |
38014396 |
T |
 |
| Q |
298 |
ttggatagctttgtggaattattttaatgtgtaccagcactactgtgttatgcttataagcaaccttgtatttgggttgtcgactagcaatttgaatata |
397 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38014395 |
ttggatagctttgtggaagtattttaatgtgtaccatcacttcagtgttatgcttataagcaaccttgtatttgggttctcgactagcaatttgaatata |
38014296 |
T |
 |
| Q |
398 |
ttctctgttttttgtggacaaattgtgagtatgttg |
433 |
Q |
| |
|
|||||||| |||||||||| | | |||||||||||| |
|
|
| T |
38014295 |
ttctctgtattttgtggactattcgtgagtatgttg |
38014260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 666 - 731
Target Start/End: Complemental strand, 38013981 - 38013915
Alignment:
| Q |
666 |
attttgatatttaattgtttaataatcattt-atcaatgtgagagattggttggcaagtatttacaa |
731 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
38013981 |
attttgacatttaattgtttaataatcattttatcaatgtgagagattagttggcaagtatttacaa |
38013915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University