View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_2D_high_5 (Length: 299)
Name: NF2085_2D_high_5
Description: NF2085_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_2D_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 74 - 281
Target Start/End: Complemental strand, 15429764 - 15429553
Alignment:
| Q |
74 |
aattcaccgatcgctaatgataagagatcttaattagattgcgagaaaaacaaaatctagctaaacacttgataatcacaagtcattgcagatcaataac |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15429764 |
aattcaccgatcgctaatgataagagatcttaattagattgcgagaaaaacaaaatctagctaaacacttgataatcacaagtcattgcagatcaataac |
15429665 |
T |
 |
| Q |
174 |
tttttattacaatgatatacatgatgtgcacttgtgggcgcttggag---nnnnnnnnctttacggtaaccc-ccagttcccaagggaaaggggaaccca |
269 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||| ||||||||| ||||| |
|
|
| T |
15429664 |
tttttattacattgatatacatgatgtgcacttgtgggcgcttggagttttttattttatttacggtaaccctccaattcccaacggaaagggggaccca |
15429565 |
T |
 |
| Q |
270 |
gtaatccaaagt |
281 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15429564 |
gtaatccaaagt |
15429553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 15429813 - 15429891
Alignment:
| Q |
1 |
tcataatatggatggttagcatcaaactgattctcataatatggatgggatattgaaagaaatgaaaagtcgaaattca |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15429813 |
tcataatatggatggttagcatcaaactgattctcataatatggatgggatattgaaagaaatgaaaagtcgaaattca |
15429891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University