View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2085_2D_low_11 (Length: 299)

Name: NF2085_2D_low_11
Description: NF2085_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2085_2D_low_11
NF2085_2D_low_11
[»] chr2 (2 HSPs)
chr2 (74-281)||(15429553-15429764)
chr2 (1-79)||(15429813-15429891)


Alignment Details
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 74 - 281
Target Start/End: Complemental strand, 15429764 - 15429553
Alignment:
74 aattcaccgatcgctaatgataagagatcttaattagattgcgagaaaaacaaaatctagctaaacacttgataatcacaagtcattgcagatcaataac 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15429764 aattcaccgatcgctaatgataagagatcttaattagattgcgagaaaaacaaaatctagctaaacacttgataatcacaagtcattgcagatcaataac 15429665  T
174 tttttattacaatgatatacatgatgtgcacttgtgggcgcttggag---nnnnnnnnctttacggtaaccc-ccagttcccaagggaaaggggaaccca 269  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||            ||||||||||||| ||| ||||||| ||||||||| |||||    
15429664 tttttattacattgatatacatgatgtgcacttgtgggcgcttggagttttttattttatttacggtaaccctccaattcccaacggaaagggggaccca 15429565  T
270 gtaatccaaagt 281  Q
    ||||||||||||    
15429564 gtaatccaaagt 15429553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 15429813 - 15429891
Alignment:
1 tcataatatggatggttagcatcaaactgattctcataatatggatgggatattgaaagaaatgaaaagtcgaaattca 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15429813 tcataatatggatggttagcatcaaactgattctcataatatggatgggatattgaaagaaatgaaaagtcgaaattca 15429891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University