View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_2D_low_13 (Length: 299)
Name: NF2085_2D_low_13
Description: NF2085_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_2D_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 15429837 - 15429553
Alignment:
| Q |
1 |
ttgatgctaaccatccatattatgaaaaaatgacaacgtgggtaatttatgtggtcttgttggcactgttcacaattcaccgatcgctaatgataagaga |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15429837 |
ttgatgctaaccatccatattatgagaaaatgacaacgtgggtaatttatgtggtcttgttggcactgttcacaattcaccgatcgctaatgataagaga |
15429738 |
T |
|
| Q |
101 |
tcttaattagattgcgagaaaaacaaaatctagctaaacacttgataatcacaagtcattgcagatcaataactttttattacaatgatatacatgatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15429737 |
tcttaattagattgcgagaaaaacaaaatctagctaaacacttgataatcacaagtcattgcagatcaataactttttattacattgatatacatgatgt |
15429638 |
T |
|
| Q |
201 |
gcacttgtgggcgcttggag---nnnnnnnnctttacggtaaccc-ccagttcccaagggaaaggggaacccagtaatccaaagt |
281 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
15429637 |
gcacttgtgggcgcttggagttttttattttatttacggtaaccctccaattcccaacggaaagggggacccagtaatccaaagt |
15429553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University