View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_2D_low_20 (Length: 266)
Name: NF2085_2D_low_20
Description: NF2085_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_2D_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 3532320 - 3532566
Alignment:
| Q |
1 |
cctggttcaattcttccatcttttatatttgctttgtataatgagaatttgaaaactggtttgggtacagagcgtcacttcgggttattgtatccaaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3532320 |
cctggttcaattcttccatcttttatatttgctttgtataatgagaatttgaaaacgggtttgggtacggagcgtcacttcgggttattgtatccaaatg |
3532419 |
T |
 |
| Q |
101 |
ggtcacgtatttatgagattgacctttctggaaagacgccagagtacgaatataagccattgccgccaccagatgattataaagggaaggcgtggtgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3532420 |
ggtcacgtatttatgagattgacctttctggaaagacgccagagtacgaatataagccattgccgccaccagatgattataaagggaaggcgtggtgtgt |
3532519 |
T |
 |
| Q |
201 |
ggtggcagagggagctaacaagacggcagtagtggaagcattgtcat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3532520 |
ggtggcagagggagctaacaagacggcagtagtggaagcattgtcat |
3532566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University