View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20860_high_1 (Length: 229)
Name: NF20860_high_1
Description: NF20860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20860_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 12221527 - 12221729
Alignment:
| Q |
13 |
cacagagctatagtaaactcacaaaaagagaggctatccatagcagcattttacggcccagaatggattggaaatataagtccaatatcatctcttgtaa |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12221527 |
cacagagctatagtaaactcagaaaaagagaggctatccatagcagcattttacggcccagaatggattggaaatataagtccaatatcatctcttgtaa |
12221626 |
T |
|
| Q |
113 |
ctccagaaacaccagcactgttcaaaacaattggtgtagcagatttctacaacggattactttcagcagaaaatcatgggaaatcatacatacatgatgt |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12221627 |
ctccagaaacaccagcattgttcaaaacaattggtgtagcagatttctacaatggattactttcaccagaaaatcatgggaaatcatacatacatgatgt |
12221726 |
T |
|
| Q |
213 |
ttt |
215 |
Q |
| |
|
||| |
|
|
| T |
12221727 |
ttt |
12221729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University