View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20860_high_5 (Length: 350)
Name: NF20860_high_5
Description: NF20860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20860_high_5 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 29 - 342
Target Start/End: Complemental strand, 45467 - 45154
Alignment:
| Q |
29 |
agtttttgtttaagcatgacaggggttttatagaaaaaggctgtttactgaaatttggattgttatatcaaggtttttgatgtctttatgatcgcataga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45467 |
agtttttgtttaagcatgacaggggttttatagaaaaaggctgtttactgaaatttggattgttatatcaaggtttttgatgtctttatgatcgcataga |
45368 |
T |
|
| Q |
129 |
agtatatttaacaattattctctgtaatatcgtggattatgtcgcgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttgga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45367 |
agtatatttaacaattattctctgtaatatcgtggattatgtcgtgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttgga |
45268 |
T |
|
| Q |
229 |
tgatgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgattttc |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45267 |
tgatgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgattttc |
45168 |
T |
|
| Q |
329 |
ttggtacctttgct |
342 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45167 |
ttggtacctttgct |
45154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University