View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20860_high_9 (Length: 330)
Name: NF20860_high_9
Description: NF20860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20860_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 28 - 301
Target Start/End: Complemental strand, 32673430 - 32673158
Alignment:
| Q |
28 |
tcaagttgatgatgaggctgaggatttcattagaaggttttatgagcagctaagaacacaaggtcgtatgcaattgcccgggttttnnnnnnnctttgcg |
127 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
32673430 |
tcaagttgacgatgaggctgaggatttcattagaaggttttatgagcagctaagaacacaaggccgtatgcaattgcctgggttttaaaaaaactttgcg |
32673331 |
T |
|
| Q |
128 |
gccacaatttggtcgagtgagatgaaggatcccaaagatagacgcgctacattttatcgggactctacaatatcaaggatcacaac---actgtaattat |
224 |
Q |
| |
|
|||||||||| | || |||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32673330 |
gccacaatttagacg-gtgatatcaaggatcccaaagttagacgcgctacattttatcgggactctacaatatcaaggatcacaacttcactgtaattat |
32673232 |
T |
|
| Q |
225 |
tattattattgtgatctcgatttaaaaccttgtaaaattggtagttactacaatgccaagagaagagatgtaaagac |
301 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32673231 |
tattattat---gatctcgatttaaaaccttgtaaaattggtagttactacaatgccaagagaagagatgtaaagac |
32673158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University