View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20861_high_1 (Length: 350)
Name: NF20861_high_1
Description: NF20861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20861_high_1 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 9 - 322
Target Start/End: Original strand, 45154 - 45467
Alignment:
| Q |
9 |
agcaaaggtaccaagaaaatcagaaacaaagtgggggcacgggcctgcacaagtgccgacatgattccgtccctgagaatgaagaatttgtgcaatttga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45154 |
agcaaaggtaccaagaaaatcagaaacaaagtgggggcacgggcctgcacaagtgccgacatgattccgtccctgagaatgaagaatttgtgcaatttga |
45253 |
T |
|
| Q |
109 |
attggtctgcatcatccaaaaaccaaattttcaagcaattctccgtgcgcaaagttttaaattgcgatcacgacataatccacgatattacggagaataa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45254 |
attggtctgcatcatccaaaaaccaaattttcaagcaattctccgtgcgcaaagttttaaattgcgatcacgacataatccacgatattacagagaataa |
45353 |
T |
|
| Q |
209 |
ttgttaaatatacttctatgcgatcataaagacatcaaaaaccttgatataacaatccaaatttcagtaaacagcctttttctataaaacccctgtcatg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45354 |
ttgttaaatatacttctatgcgatcataaagacatcaaaaaccttgatataacaatccaaatttcagtaaacagcctttttctataaaacccctgtcatg |
45453 |
T |
|
| Q |
309 |
cttaaacaaaaact |
322 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45454 |
cttaaacaaaaact |
45467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University