View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20862_high_10 (Length: 304)
Name: NF20862_high_10
Description: NF20862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20862_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 276
Target Start/End: Original strand, 5687761 - 5688048
Alignment:
| Q |
10 |
ataatacttggtcaaattacagagatat--gacccacatcaattcaatttttgctctatttgttaatccttattataattgtgccactga---------- |
97 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5687761 |
ataatacatggtcaaattacagagatatatgacccacatcaattcaatttttgctctatttgttaatccttattataattgtgccactgatcatgaacaa |
5687860 |
T |
|
| Q |
98 |
----------aatcaggatctacaagccaaaccattctcaaacttgagtctagattgaacccttatatgtcttggccatggatcatttgataataatata |
187 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5687861 |
aagccactgaaatcaggatctacaagccaaac-attctcaaacttgagtctagattgaacccttatatgtcttggccttggatcatttgataataatata |
5687959 |
T |
|
| Q |
188 |
ggatagtgattggaaaacaaaaaatgccacaattcataccacggtcaccactctaaccgttccaagactcttgaaccaagtaaacaaat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5687960 |
ggatagtgattggaaaacaaaaaatgccacaattcataccacggtcaccactctaaccgttccaagactcttgaaccaagtaaacaaat |
5688048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University