View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20862_high_7 (Length: 319)
Name: NF20862_high_7
Description: NF20862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20862_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 29 - 311
Target Start/End: Original strand, 41319920 - 41320202
Alignment:
| Q |
29 |
ataaaattgattatgatcgtattttcttagaatcctaatcaaattttcggtgacgaagacggtatcatcgtcacccatgacgaaccaccgtacatctttc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41319920 |
ataaaattgattatgatcgtattttcttagaatcctaatcaaattttcggtgacgaagacggtatcatcgtcacccatgacgaaccaccgtacatctttc |
41320019 |
T |
 |
| Q |
129 |
actccgagccggagtgtttccgagacgattcgtgagattcggattgcggaacggtgaccttgtttgtttttataagcgaattttgaagtgtcgccggaga |
228 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320020 |
attccgagccggagtgtttccgatacgattcgtgagattcggattgcggaacggtgaccttgtttgtttttataagcgaattttgaagtgtcgccggaga |
41320119 |
T |
 |
| Q |
229 |
ttctcaccggcgggagccgactttcgttcttttgggttttaaccttgttgtctagccatactacaccacgcatttcctttgct |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320120 |
ttctcaccggcgggagccgactttcgttcttttgggttttaaccttgttgtctagccatactacaccacgcatttcctttgct |
41320202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University