View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20864_high_6 (Length: 225)
Name: NF20864_high_6
Description: NF20864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20864_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 43452050 - 43451860
Alignment:
| Q |
18 |
aagtatctccacaaacccattaataattggaggttttgatagcatgctgtggatatccactcccagattccctcctctccacaacttctctatttgaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43452050 |
aagtatctccacaaacccattaataattggaggttttgatagcatgctgtggatatccactcccagattccctcctctccacaatttctctatttgaaga |
43451951 |
T |
|
| Q |
118 |
gccgccatttcagattcctggagaatctctgacatgtacaggttattgattgcacagcgtaactcgccaatcatcccatcaacagtggcct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43451950 |
gccgccatttcagattcctggagaatctctgacatgtacaggttattgattgcacagcgtaactcgccaatcatcccatcaacagtggcct |
43451860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University