View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20864_low_5 (Length: 228)
Name: NF20864_low_5
Description: NF20864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20864_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 23 - 204
Target Start/End: Original strand, 46014830 - 46015004
Alignment:
| Q |
23 |
actaatttattttttgacaccttgtgnnnnnnngaaattgaaattgtataaatatgatatgttggcgatgcaattgaaagaaagaaagaaacagatnnnn |
122 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
46014830 |
actaaattattttttgacaccttgtgaaaaaaagaaattgaaattgtatacatatgatatgtcggcgatgca-------gaaagaaagaaacagataaaa |
46014922 |
T |
 |
| Q |
123 |
nnncaagatgcttgatgaatgtgttaaaataaaaggtgttcgaatatcattcttgattctaaaactaccttgatttctaaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
46014923 |
aaacaagatgcttgatgaatgtgttaaaataaaaggtgttcgaatatcattgttgattctaaaactactttgatttttaaat |
46015004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University