View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20865_high_3 (Length: 298)
Name: NF20865_high_3
Description: NF20865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20865_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 75 - 255
Target Start/End: Original strand, 3300309 - 3300485
Alignment:
| Q |
75 |
attagttagatgagatttgagcgtgaggggtaataaaaggtgagtggttttgatttgatgaatgagcaacattgtaagcaatgagttggaaatgagtagt |
174 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
3300309 |
attagttaaatgagatttgagtgtgaggagtaataaaaggtgagtggttttgatttgatga----gcaacattgtaagtattgagttggaaatgagtagt |
3300404 |
T |
|
| Q |
175 |
gaataaaattacgtggatgaagggttctgcatggtttggcttttgcgtgggaaattttgggggtggtttcctattttgtac |
255 |
Q |
| |
|
|||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3300405 |
gaataacattacgtagatgaagggttttgcatggtttggcttttgcgtgggaaattttggaggtggtttcctattttgtac |
3300485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 2 - 67
Target Start/End: Complemental strand, 3300252 - 3300187
Alignment:
| Q |
2 |
gttataccacgatgttgtgtcttcctattatggatagtgtttctagcattgtgtataacggcgttg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3300252 |
gttataccacgatgttgtgtcttcctattatggatagtggttctagcattgtgtataacggcgttg |
3300187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University