View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20866_low_4 (Length: 312)
Name: NF20866_low_4
Description: NF20866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20866_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 188 - 300
Target Start/End: Complemental strand, 29022030 - 29021918
Alignment:
| Q |
188 |
actatatatgatccaacaccacctttcctttgtgacttattccctagattctccaacctcaactctctcgacctaaggtgctactatggtgacctcgact |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29022030 |
actatatatgatccaacaccacctttcctttgtgacttattccctagattctccaacctcaactctctcgacctaaggtgctactatggtgacctcgact |
29021931 |
T |
|
| Q |
288 |
cgcttctctttca |
300 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29021930 |
cgcttctctttca |
29021918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 20 - 127
Target Start/End: Complemental strand, 29022198 - 29022091
Alignment:
| Q |
20 |
ataaaaacaatgacttcagatctttatttacctgacgagtgttgggaatgcatcttcaaattcttattcaaagacggtgacgacgacgataaccgttgct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
29022198 |
ataaaaacaatgacttcagatctttatttacctgacgagtgttgggaatgcatcttcaaattcctcttcaaagacggtgacgacgacgataaccgttgct |
29022099 |
T |
|
| Q |
120 |
ctttcaag |
127 |
Q |
| |
|
|||||||| |
|
|
| T |
29022098 |
ctttcaag |
29022091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 188 - 300
Target Start/End: Original strand, 28661017 - 28661129
Alignment:
| Q |
188 |
actatatatgatccaacaccacctttcctttgtgacttattccctagattctccaacctcaactctctcgacctaaggtgctactatggtgacctcgact |
287 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||| |||||||||||||||| || ||||| ||| |||| |||| |
|
|
| T |
28661017 |
actatatatgatccaacaccacccttcctctgtagtctattccctagattctccaacctgaactctctcgacctaacatgttactacggtaaccttgact |
28661116 |
T |
|
| Q |
288 |
cgcttctctttca |
300 |
Q |
| |
|
| ||||| ||||| |
|
|
| T |
28661117 |
cacttctatttca |
28661129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 39 - 99
Target Start/End: Original strand, 28660880 - 28660940
Alignment:
| Q |
39 |
atctttatttacctgacgagtgttgggaatgcatcttcaaattcttattcaaagacggtga |
99 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||||||||| | ||||| || ||||| |
|
|
| T |
28660880 |
atcttcatttacgtgactagtgttgggaatgcatcttcaaattcctcttcaacgatggtga |
28660940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 44 - 95
Target Start/End: Original strand, 13469172 - 13469223
Alignment:
| Q |
44 |
tatttacctgacgagtgttgggaatgcatcttcaaattcttattcaaagacg |
95 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||| ||||||| |||| |
|
|
| T |
13469172 |
tatttacctgacgagtgttgggaacgtatcttcaaatttatattcaacgacg |
13469223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 44 - 90
Target Start/End: Complemental strand, 10616246 - 10616200
Alignment:
| Q |
44 |
tatttacctgacgagtgttgggaatgcatcttcaaattcttattcaa |
90 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
10616246 |
tatttacctgatgagtgttgggaatgtatcttcaaatttatattcaa |
10616200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 44 - 82
Target Start/End: Original strand, 1547373 - 1547411
Alignment:
| Q |
44 |
tatttacctgacgagtgttgggaatgcatcttcaaattc |
82 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1547373 |
tatttacctgacgagtgttgggaatctatcttcaaattc |
1547411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 84
Target Start/End: Original strand, 44575097 - 44575137
Alignment:
| Q |
44 |
tatttacctgacgagtgttgggaatgcatcttcaaattctt |
84 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
44575097 |
tatttacctgatgagtgttgggaacacatcttcaaattctt |
44575137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University