View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20867_high_2 (Length: 384)
Name: NF20867_high_2
Description: NF20867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20867_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 10 - 369
Target Start/End: Complemental strand, 51758125 - 51757766
Alignment:
| Q |
10 |
tcataggtgtggtgcaattgtgggcagcgatatgcatactatttgaaattgtcttaatgcaataactatatggagatatttttgtcccacttatcctcat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||| | |
|
|
| T |
51758125 |
tcataggtgtggtgcaattgtgggcagcgatatgcatactctttgaaattgtcttaatgcaatatctatatggaggtatttttgtctcacttatcctcgt |
51758026 |
T |
 |
| Q |
110 |
gatttttacgtaaaatttttctagagttaaacaccatgctactactgatgcatgcactatgttcatataacttgttttgagacttggaagagattttcct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
51758025 |
gatttttacgtaaaatttttctagagttaaacaccatgctactactgatgcatgcactatgttcatataacttgttttaagatttggaagagattttcct |
51757926 |
T |
 |
| Q |
210 |
gaatgtggnnnnnnnttgggctccaaataatagtatattatcgtatcattcttcatggtccatacccttggttgtgcaaatacaaatcatgtgattcttc |
309 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51757925 |
gaatgtggaaaaaaattgggctccagataatagtatattatcgtatcattcttcatggtccatgcccttggttgtgcaaatacaaatcatgtgattcttc |
51757826 |
T |
 |
| Q |
310 |
atgttcttcgacatccctctttggaaggctttattaaattcaacatggatggatcctctt |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51757825 |
gtgttcttcgacatccctctttggaaggctttattaaattcaacatggatggatcctctt |
51757766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University