View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_high_128 (Length: 217)
Name: NF20869_high_128
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_high_128 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 5115673 - 5115771
Alignment:
| Q |
10 |
ataatactatttgattgatgacttgtaattttgttacacaactttcaaaattgaagagtgataactagccactgtcaatggtgggatataatgttcttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5115673 |
ataatactatttgattgatgacttgtaattttgttacacaactttcaaaattgaagagtgataactagccactgtcaatggtgggatacaatgttcttg |
5115771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 190
Target Start/End: Original strand, 5115813 - 5115850
Alignment:
| Q |
153 |
atgatagctcgagaggcaaatcagcaggcattaaatta |
190 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5115813 |
atgattgctcgagaggcaaatcagcaggcattaaatta |
5115850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University