View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_high_134 (Length: 205)
Name: NF20869_high_134
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_high_134 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 187
Target Start/End: Original strand, 6878451 - 6878621
Alignment:
| Q |
17 |
gagaaaatgatgaatggtaagcatgataaggttttaaagctcgccccgccatcaacagtgggtggagttgggcttgctttaaggtatgctaatctgatcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
6878451 |
gagaaaatgatgaatggtaagcatgataaggttttaaagctcgccccgccatcaacagtgggtggagttgggcttgctttgaggtatgctaatttgatcc |
6878550 |
T |
|
| Q |
117 |
tactggcggagcgttgtctccatgcgcccgcgacagttggagaggacgcacgtgaggccttatacgagatg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878551 |
tactggcggagcgttgtctccatgcgcccgcgacagttggagaggacgcacgtgaggccttatacgagatg |
6878621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University