View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_high_45 (Length: 375)
Name: NF20869_high_45
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_high_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 11 - 369
Target Start/End: Complemental strand, 40325469 - 40325111
Alignment:
| Q |
11 |
acatcatcattcaccctttcggttaaacgatcagttgcttcaannnnnnncttaacatgatctcggtttgaaatcaccttcatcttttcgctttccacat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40325469 |
acatcatcattcaccctttcggttaaacgatcagttgcttcaatttttttcttaacatgatctcggtttgaaatcaccttcatcttttcgctttccacat |
40325370 |
T |
|
| Q |
111 |
tttttattgttttgcgagcccgattgtcacgtcgttcgtcgatttggcttaccagaatacaagttccgactaagcaagtagcaattatggattgtttgta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40325369 |
tttttattgttttgcgagcccgattgtcacgtcgttcgtcgatttggcttaccagaatacaagttccgactaagcaagtagcaattatggattgtttgta |
40325270 |
T |
|
| Q |
211 |
agtagtaataaatccagtgggaaggtaatctgaaaataatcaatataaatttcagtggtagatttaaaaaagataaattactatataaatggaatttagc |
310 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40325269 |
agtagtaataaatccagtgggaagataatctgaaaataatcaatataaatttcagtggtagatttaataaagataaattactatataaatggaatttagc |
40325170 |
T |
|
| Q |
311 |
tatgccttcagtgataattgttttgnnnnnnnggtggtgttcggggtttgagtctcata |
369 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
40325169 |
tatgccttcagtgataattgttttgcttttttggtggtgtctggggtttgagtctcata |
40325111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University