View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_high_50 (Length: 356)
Name: NF20869_high_50
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_high_50 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 17 - 356
Target Start/End: Complemental strand, 41301277 - 41300939
Alignment:
| Q |
17 |
atgaagggctgttgataaacctttataaacacaagttgcattgcattcattaaagagcatgcaatctcatccttaaaattaaccctagtagtgcctccaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41301277 |
atgaagggctgttgataaacctttataaacacaagttgcattgcattcattaaagagcatgcaatctcatccttaaaattaaccctagtagtgcctccaa |
41301178 |
T |
|
| Q |
117 |
cactaattgaaaagccaatttaattttttagaaaggcaccggcgaaccaattataaaaatgacatatcataaagcaaacaattcttattggcacaagaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41301177 |
tactaattgaaaagccaatttaattttttagaaaggcaccggcgaaccaattataaaaatgacatatcataaagcaaacaattcttattggcacaagaac |
41301078 |
T |
|
| Q |
217 |
ttgtctttatgaggtgaataagggaccacaatctccaaattatctttgatattttctctcnnnnnnnnnnnnnagcatccaaccaaaattgctcaaccaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41301077 |
ttgtctttatgaggtgaataagggaccacaatctccaaattatctttgatattttctctc-ttttttgtttttagcatccaaccaaaattgctcaaccaa |
41300979 |
T |
|
| Q |
317 |
atgatttattgttcttcttgaaatattcttttcatattct |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41300978 |
atgatttattgttcttcttgaaatattcttttcattttct |
41300939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University