View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_high_82 (Length: 280)
Name: NF20869_high_82
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_high_82 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 181 - 267
Target Start/End: Original strand, 2291584 - 2291671
Alignment:
| Q |
181 |
ggctgttctgttgcaaattgaattagtttttgttagtatgttattcttctttgtactttgat-actattttacgtaaatgttgtttct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
2291584 |
ggctgttctgttgcaaattgaattagtttttgttagtatgttattcttctttgtactttgataactattttacgtaaatgttatttct |
2291671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 61 - 109
Target Start/End: Original strand, 2291471 - 2291519
Alignment:
| Q |
61 |
ttcatctttttgttgttatgctattcacctacttactgattggttggtg |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2291471 |
ttcacctttttgttgttatgctattcacctacttactgattggttggtg |
2291519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University