View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_100 (Length: 250)
Name: NF20869_low_100
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_100 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 42 - 250
Target Start/End: Original strand, 38900560 - 38900768
Alignment:
| Q |
42 |
ttgagacattctcgtgcatcggtcattattattgtgaatgcttataaagacattcttattatgtcaaaacttaaaacaatttagagagtgaagctattga |
141 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38900560 |
ttgagacattctcgtttatccgtcattattattgtgaatgcttataaagacattcttattatgtcaaaacttaaaacaatttagagagtggagctattga |
38900659 |
T |
 |
| Q |
142 |
ctaattggaggaataaatttggataaacaaatagttaaaaggataaaggagaggttgtacgaaatcataaaataaaatagcattaatacaatatatatta |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38900660 |
ctaattggaggaatgaatttggataaacaaatagttaaaaggataaaggagaggttgtacgaaatcataaaataaaattgcattaatacaatatatatta |
38900759 |
T |
 |
| Q |
242 |
tggttaata |
250 |
Q |
| |
|
||||||||| |
|
|
| T |
38900760 |
tggttaata |
38900768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University