View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_116 (Length: 239)
Name: NF20869_low_116
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_116 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 45647226 - 45647450
Alignment:
| Q |
1 |
ctatactgttgtatttattttatcaactactcgaatatgcatactttaaacttatttatgttttaaatttgggtttctcctggtgaaatgctctgacgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45647226 |
ctatactgttgtatttattttatcaactactcgaatatgcatactttaaacttatttatgttttaaatttgggtttctcctagtgaaatgctctgacgag |
45647325 |
T |
 |
| Q |
101 |
cttcttaagaatttcagaaaatcggcataatggaaggcgttgtttcgaacacgaggagatgggaggatctggacacagatattttggtgaagatttttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45647326 |
cttcttaagaatttcagaaaatcggcataatggaaggcattgtttcgaacacgaggagatgggaggatctggacacagatattttggtgaagatttttct |
45647425 |
T |
 |
| Q |
201 |
gttgcttgacatcttcgggttaact |
225 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
45647426 |
gttgcttgacatcttcgagttaact |
45647450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 128 - 225
Target Start/End: Original strand, 45642340 - 45642437
Alignment:
| Q |
128 |
taatggaaggcgttgtttcgaacacgaggagatgggaggatctggacacagatattttggtgaagatttttctgttgcttgacatcttcgggttaact |
225 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
45642340 |
taatggaagacgttgtttcgaacacgaggagatgggaggatctggacacagatattttggtgaagatttttcagttgcttgacatattcgagttaact |
45642437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University