View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_119 (Length: 236)
Name: NF20869_low_119
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_119 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 5 - 116
Target Start/End: Complemental strand, 33994199 - 33994085
Alignment:
| Q |
5 |
ttaagatcatcaattgttttgttgacagttgccaaggtcaccacctc---atcattcgagttttggtcgacctggttcacctcagcggcatcagggataa |
101 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| ||||| |||||||||||||||||| ||||||||| | ||||||||||||| |
|
|
| T |
33994199 |
ttaagatcatcaatttttttgttgacagttaccaaggtcaccacctcctcatcatccgagttttggtcgacctgattcacctcatcagcatcagggataa |
33994100 |
T |
 |
| Q |
102 |
caactgtatcaatcg |
116 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33994099 |
caactgtatcaatcg |
33994085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University