View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20869_low_120 (Length: 236)

Name: NF20869_low_120
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20869_low_120
NF20869_low_120
[»] chr5 (1 HSPs)
chr5 (14-184)||(26147133-26147301)
[»] chr3 (1 HSPs)
chr3 (39-110)||(45575399-45575470)
[»] chr4 (1 HSPs)
chr4 (43-111)||(20384800-20384868)


Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 184
Target Start/End: Original strand, 26147133 - 26147301
Alignment:
14 tggtagtgttattgtgactgctgccgcaattcaatgtaaagcttcttggttaccagatcacagtctaggtcatagattagaagttattttatgttgtacg 113  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
26147133 tggtagtattattgtgactgctgccgcaattcaatgtaaagcttcttcgttaccagatcacagtctaggtcatagattaggagttattttatgttgtacg 26147232  T
114 attcgattgcttttttggaaaaatggtgtattaaaagtctgaaaatgattcatgttttattcaaatcatag 184  Q
    | | ||||||||||||||  |||||||||||||||||||| ||||||||||||||||||| ||||||||||    
26147233 acttgattgcttttttgg--aaatggtgtattaaaagtctaaaaatgattcatgttttatccaaatcatag 26147301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 39 - 110
Target Start/End: Complemental strand, 45575470 - 45575399
Alignment:
39 gcaattcaatgtaaagcttcttggttaccagatcacagtctaggtcatagattagaagttattttatgttgt 110  Q
    ||||||||||||| |||| ||| |||||| ||||||||||  |||| ||||||||||||| |||| ||||||    
45575470 gcaattcaatgtagagctcctttgttaccggatcacagtcagggtcgtagattagaagttgttttctgttgt 45575399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 20384868 - 20384800
Alignment:
43 ttcaatgtaaagcttcttggttaccagatcacagtctaggtcatagattagaagttattttatgttgta 111  Q
    ||||||||| | ||| || |||||||||||||| ||   ||||||||||| ||||| ||||||||||||    
20384868 ttcaatgtagaacttattcgttaccagatcacaatcagtgtcatagattacaagttgttttatgttgta 20384800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University