View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_120 (Length: 236)
Name: NF20869_low_120
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_120 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 184
Target Start/End: Original strand, 26147133 - 26147301
Alignment:
| Q |
14 |
tggtagtgttattgtgactgctgccgcaattcaatgtaaagcttcttggttaccagatcacagtctaggtcatagattagaagttattttatgttgtacg |
113 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26147133 |
tggtagtattattgtgactgctgccgcaattcaatgtaaagcttcttcgttaccagatcacagtctaggtcatagattaggagttattttatgttgtacg |
26147232 |
T |
 |
| Q |
114 |
attcgattgcttttttggaaaaatggtgtattaaaagtctgaaaatgattcatgttttattcaaatcatag |
184 |
Q |
| |
|
| | |||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
26147233 |
acttgattgcttttttgg--aaatggtgtattaaaagtctaaaaatgattcatgttttatccaaatcatag |
26147301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 39 - 110
Target Start/End: Complemental strand, 45575470 - 45575399
Alignment:
| Q |
39 |
gcaattcaatgtaaagcttcttggttaccagatcacagtctaggtcatagattagaagttattttatgttgt |
110 |
Q |
| |
|
||||||||||||| |||| ||| |||||| |||||||||| |||| ||||||||||||| |||| |||||| |
|
|
| T |
45575470 |
gcaattcaatgtagagctcctttgttaccggatcacagtcagggtcgtagattagaagttgttttctgttgt |
45575399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 20384868 - 20384800
Alignment:
| Q |
43 |
ttcaatgtaaagcttcttggttaccagatcacagtctaggtcatagattagaagttattttatgttgta |
111 |
Q |
| |
|
||||||||| | ||| || |||||||||||||| || ||||||||||| ||||| |||||||||||| |
|
|
| T |
20384868 |
ttcaatgtagaacttattcgttaccagatcacaatcagtgtcatagattacaagttgttttatgttgta |
20384800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University