View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_121 (Length: 233)
Name: NF20869_low_121
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_121 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 8 - 222
Target Start/End: Original strand, 6387012 - 6387232
Alignment:
| Q |
8 |
gtttattgaataaccaatatatttagttcaaaca-------aataaaacttattcggtgaatagaaaaaattattttcttatataannnnnnnnngaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||| ||||||| |||||||||| |||| | ||||| |||||| ||||| |
|
|
| T |
6387012 |
gtttattgaataaccaatatatttagtttaaacataaaccaaataatacttattgggtgaatagataaaaaaaatttctaatataattattttttgaaac |
6387111 |
T |
 |
| Q |
101 |
aatttttcttatataataagaaaccgatgtattatatgttatattttgacacttttatatgtttatgctcaaattaatgattttctggtctattaagatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6387112 |
aatttttcttatataataagaaaccgatgtattatatgtta-attttgacacttttatatgtttatgctcaaattaatgattttctggtctattaagatt |
6387210 |
T |
 |
| Q |
201 |
aagcatcacacatgagattggt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6387211 |
aagcatcacacatgagattggt |
6387232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University