View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_122 (Length: 233)
Name: NF20869_low_122
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_122 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 31025071 - 31025284
Alignment:
| Q |
1 |
caaaagaaataaagaaattgtggaagcatattaggttggttcgcctgttgatatatatatgtgatctattttggggtattgtgaggaaaccttgtgacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31025071 |
caaaagaaataaagaaattgtggaagcatattaggttggttcgcctgttgatatatatatgtgatctattttggggtattgtgaggaaaccttgtgacct |
31025170 |
T |
 |
| Q |
101 |
gaaaacattaaaagcaaaatatggttctcgatctaatctaggacaaaacgtagggatatggaaatggttatttgtgagcttatttcttgagtttgcactt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31025171 |
gaaaacatttaaagcaaaatatggttctcgatctaatctaggacaaaacgtagggatatggaaatggttatttgtgagcttatttcttgagtttgcactt |
31025270 |
T |
 |
| Q |
201 |
ggcaatattttgat |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31025271 |
ggcaatattttgat |
31025284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 74 - 148
Target Start/End: Original strand, 31037112 - 31037186
Alignment:
| Q |
74 |
gggtattgtgaggaaaccttgtgacctgaaaacattaaaagcaaaatatggttctcgatctaatctaggacaaaa |
148 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| | | |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
31037112 |
gggtattgtaaggaaaccttgtaacctgaaaaagtaagaagcaaaatatggttctcgatctagtataggacaaaa |
31037186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University