View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_125 (Length: 227)
Name: NF20869_low_125
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_125 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 7333741 - 7333525
Alignment:
| Q |
1 |
tttgttacggttttctgatagaactcataggcctgatttgactttcatgtggatacggtgtggaccctcataggccagctatttggaaagtgtatgtctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7333741 |
tttgttacggttttctgatagaactcataggcctgatttgactttcatgtggatacggtgtggaccctcataggccagctatttggaaagtttatgtctg |
7333642 |
T |
|
| Q |
101 |
gaaaaagaaggtggcacgaatattctctaggtggttaaaggagagagtatgtaatgaggtgatagggagtggagacttatctcgggtaggagtcatagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7333641 |
gaaaaagaaggtggcacgaatattctctaggtggttaaaggagagagtatgtaatgaggtgatagggagtggagacttatctcgggtaggagtcatagac |
7333542 |
T |
|
| Q |
201 |
tctggtatttccctttg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7333541 |
tctggtatttccctttg |
7333525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 46 - 111
Target Start/End: Original strand, 12427018 - 12427084
Alignment:
| Q |
46 |
catgtggatac-ggtgtggaccctcataggccagctatttggaaagtgtatgtctggaaaaagaagg |
111 |
Q |
| |
|
||||||||||| ||||| ||||| |||||| |||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
12427018 |
catgtggatactggtgttgacccccataggtcagcaatttggaaagtgtatgtcaggaaaaggaagg |
12427084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University