View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_133 (Length: 210)
Name: NF20869_low_133
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_133 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 41351757 - 41351558
Alignment:
| Q |
1 |
gattgaaacaaatgataaattcagatagcatcacaaaaattcaaattcaattgcaaaacacaagaatttggtgtgtatgtgtgcacgaggacaggaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41351757 |
gattgaaacaaatgataaattcagatagcatcacaaaaattcaaattcaattgcaaaacacaagaatttggtgtgtatgtgtgcacgaggacaggaggat |
41351658 |
T |
|
| Q |
101 |
tcaaattacctcggagatattgtcatctacacaatccgattgtgatggagacggaagagggtaaaatttccccttcaatatgtctttctccctttctctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41351657 |
tcaaattacctcggagatattgtcatctacacaatctgattgggatggagacggaagagggtaaaatttccccttcaatatgtctttctccctttctctg |
41351558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 5 - 43
Target Start/End: Complemental strand, 36228892 - 36228854
Alignment:
| Q |
5 |
gaaacaaatgataaattcagatagcatcacaaaaattca |
43 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36228892 |
gaaacaaatgataaatttagatagcatcacaaaaattca |
36228854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University