View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_134 (Length: 207)
Name: NF20869_low_134
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_134 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 34085751 - 34085922
Alignment:
| Q |
15 |
cacagagagggatgagagaggtggcacgatcatggaggggttgcgcgtcgaagacattgtcaacgaatcatgccctgaagtaggagactaagagcataat |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34085751 |
cacaaagagggatgagagaggtggcacgatcatggaggggttgcgcgtcgaagacattgtcaacgaatcatgccctgaagtaggagactaagagcataat |
34085850 |
T |
|
| Q |
115 |
gtcggacaccgagatccccgtaacaagagaaaccaatgtattttccttaaaattagttgagtggttgaacac |
186 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |||||||||||||||||||||| || ||||||| |
|
|
| T |
34085851 |
gtcggacaccgagattcccataacaagagaaaccaatgcattttccttaaaattagttgagaggctgaacac |
34085922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University