View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_48 (Length: 360)
Name: NF20869_low_48
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 17 - 344
Target Start/End: Original strand, 10995474 - 10995801
Alignment:
| Q |
17 |
aggttctaagcattaagatctcacagacagtctatgagaaaggattggatgcttgcaagcggaatttatgcggtcaattggttttaaacaagggtgataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
10995474 |
aggttctaagcattaagatctcacagacagtctatgagaaaggattggatgcttgcaagcggaatttacgtggtcaattggttttaaacaagggtgataa |
10995573 |
T |
|
| Q |
117 |
accttacatgaaaaaggatctagaaatgaaaatctttggaagattacaggcgcgtggtccttgcgttctttaggaaggggattttatgaattctcatttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10995574 |
accttacatgaaaaaggatctagaaatgaaaatctttggaatattacaggcgcgtggtccttgcgttctttaggaaggggattttatgaattctcatttg |
10995673 |
T |
|
| Q |
217 |
cctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaacctggacttttacggttgttcgaatggactaaagacttcagtatcta |
316 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10995674 |
cctccgaggatgatttacgatcggtttgggcgttgggtacggtgaatttgaaacctggacttttacggttgttcgaatggactaaagacttcagtatcta |
10995773 |
T |
|
| Q |
317 |
tacgcaacgtaacactcacgcacaggtt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10995774 |
tacgcaacgtaacactcacgcacaggtt |
10995801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 340
Target Start/End: Complemental strand, 14243627 - 14243297
Alignment:
| Q |
17 |
aggttctaagcattaagatctcacagacagtctatgagaaaggattggatgcttgcaagcggaatttatgcggtcaattggttttaaacaagggtgataa |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||| || |||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
14243627 |
aggttctaagcattaagatctcgcagacagtgtatgagaaaggattggttgtttgcaagcggaatttacgcggtcgtttggttttgaacaagggtgataa |
14243528 |
T |
|
| Q |
117 |
accttacatgaaaaaggatctagaaatgaaaat-------ctttggaagattacaggcgcgtggtccttgcgttctttaggaaggggattttatgaattc |
209 |
Q |
| |
|
||||||||||||||| ||||||||| ||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14243527 |
accttacatgaaaaatgatctagaactgaaacttcagaagctttggaagattacaggcgcgtggtccttgtgttctttaggaaggggattttatgaattc |
14243428 |
T |
|
| Q |
210 |
tcatttgcctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaacctggacttttacggttgttcgaatggactaaagacttca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
14243427 |
tcatttgcctccgaggatgatttacgatcggtttgggcgatgggtacggtgaatttgaaacctggactgttgcggttgttcgaatggactaaagacttca |
14243328 |
T |
|
| Q |
310 |
gtatctatacgcaacgtaacactcacgcaca |
340 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |
|
|
| T |
14243327 |
gtatctatacgcaatgtaacactcacgcaca |
14243297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 150 - 274
Target Start/End: Original strand, 8478272 - 8478396
Alignment:
| Q |
150 |
ctttggaagattacaggcgcgtggtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcga |
249 |
Q |
| |
|
|||||||||| |||||||||||||| | | ||||||||| ||||| | ||||||||| | |||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
8478272 |
ctttggaagacatcaggcgcgtggtcccttctttctttaggtaggggttattatgaattttattttgcctccgaggaagatttacgatcggtttgggcga |
8478371 |
T |
|
| Q |
250 |
tgggtacggtgaatttgaaacctgg |
274 |
Q |
| |
|
|||| ||||| |||||||||||||| |
|
|
| T |
8478372 |
tgggaacggtaaatttgaaacctgg |
8478396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 150 - 296
Target Start/End: Complemental strand, 19937911 - 19937765
Alignment:
| Q |
150 |
ctttggaagattacaggcgcgtggtccttgcgttctttaggaaggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcga |
249 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||||||| ||||| | ||||||||| | |||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
19937911 |
ctttggaagacatcaggcgcgtggtccctgctttctttaggtaggggttattatgaattttattttgcctccgaggaagatttacgatcggtttgggcga |
19937812 |
T |
|
| Q |
250 |
tgggtacggtgaatttgaaacctggacttttacggttgttcgaatgg |
296 |
Q |
| |
|
|||| ||||| |||||||||||||| | ||| ||||||| |||||| |
|
|
| T |
19937811 |
tgggaacggtaaatttgaaacctggtttgttaaggttgtttgaatgg |
19937765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 340
Target Start/End: Complemental strand, 22982201 - 22982053
Alignment:
| Q |
192 |
aggggattttatgaattctcatttgcctccgaggatgatttacgattggtttgggcgatgggtacggtgaatttgaaacctggacttttacggttgttcg |
291 |
Q |
| |
|
||||| || |||||||||| |||||||| ||||||||| | || |||| |||| ||||| ||||| |||||||| || ||| || | || ||||| | |
|
|
| T |
22982201 |
aggggtttctatgaattcttttttgcctctgaggatgatatgcgcatggtatgggttatggggacggtcaatttgaagcccggagttctccgattgtttg |
22982102 |
T |
|
| Q |
292 |
aatggactaaagacttcagtatctatacgcaacgtaacactcacgcaca |
340 |
Q |
| |
|
||||||| |||||||||| ||| | | |||||||||||||| ||||| |
|
|
| T |
22982101 |
aatggaccaaagacttcaatatgcacaaacaacgtaacactcatgcaca |
22982053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University