View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_72 (Length: 308)
Name: NF20869_low_72
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 63 - 290
Target Start/End: Original strand, 6667673 - 6667900
Alignment:
| Q |
63 |
ttatgctaacaacttgctttgccttttcccttcaccaatttggctcacttttacccttcccgtaatttcttattccctatctttcactttcattcagatg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6667673 |
ttatgctaacaacttgctttgccttttcccttcaccaatttggctcacttttacccttcccgtaatttcttattccctatctttcactttcattcagatg |
6667772 |
T |
 |
| Q |
163 |
gggttttcacagccacaccaccgcttgcaaccattgccacatctccttgcaaccaccgccacttctcttcaacgggaatcctttttgctagatagtgaac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6667773 |
gggttttcacagccacaccaccgcttgcaaccactgccacatctccttgcaaccaccgccacttctcttcaacgggaatcctttttgctagatagtgaac |
6667872 |
T |
 |
| Q |
263 |
aaattctgctttgcaaggaacaaagagc |
290 |
Q |
| |
|
||||||||||||| |||||||||||||| |
|
|
| T |
6667873 |
aaattctgctttgtaaggaacaaagagc |
6667900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University