View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_80 (Length: 283)
Name: NF20869_low_80
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_80 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 208
Target Start/End: Original strand, 49605693 - 49605894
Alignment:
| Q |
7 |
gattattctcgaaatggttttgtgcagatttccagttcataatcgtcatgcctttgatgtagatgctgagttgattgattatccggtgtgtcttgggtcg |
106 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49605693 |
gattcttctcgaaatggttttgtgcatatttccagttcataatcgtcatgcctttgatgtagatgctgagttgattgattatccggtgagtcttgggtcg |
49605792 |
T |
 |
| Q |
107 |
ttggagcttcaacaaaaattaatctatggtgcattatgcgtgtttgaacaacaaataatatgatatagactatgaactcaacaagaaaaagagtgttttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49605793 |
ttggagcttcaacaaaaattaatctatggtgcattatgcgtgtttgaacaacaaataatatgatatagactatgaactcaacaagaaaaagagtgttttg |
49605892 |
T |
 |
| Q |
207 |
tg |
208 |
Q |
| |
|
|| |
|
|
| T |
49605893 |
tg |
49605894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 203 - 283
Target Start/End: Complemental strand, 49605382 - 49605302
Alignment:
| Q |
203 |
tttgtgaacacataagttttgttctagaaaaatgtggggtgaatggatgaaaaaggataaacgtgatagtttatgtcaaat |
283 |
Q |
| |
|
||||||||| |||||||| ||||| ||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
49605382 |
tttgtgaacgcataagttatgttccagaaaaatgtggggtgaatgggtgaaaaaggataaacttgatagtttgtgtcaaat |
49605302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 38576 - 38523
Alignment:
| Q |
156 |
aacaaataatatgatataga-ctatgaactcaacaagaaaaagagtgttttgtg |
208 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||||||||| ||||| |||||| |
|
|
| T |
38576 |
aacaaataatatgctatagatcaatgaactcaacaagaaaaggagtgctttgtg |
38523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University