View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_83 (Length: 281)
Name: NF20869_low_83
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 22 - 207
Target Start/End: Original strand, 52452728 - 52452909
Alignment:
| Q |
22 |
gtaaagtccaattaatagctaaaagtcatctgtttttctctgatatcaattcaaaacacagaaatctcatctaagaacgaacaaattttgttctttttct |
121 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52452728 |
gtaaagtccaattaatagctaaaagtcttctgtttttctctgatatcaattcaaaacacagaaatctcatctaa----gaacaaattttgttctttttct |
52452823 |
T |
|
| Q |
122 |
ttaggccaagggctaannnnnnncatatctatctgttattctataataaatcatagtacatataaatatgtcaaagtttcaaccat |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52452824 |
ttaggccaagggctaatttttttcatatctatctgttattctataataaatcatagtacatataaatatgtcaaagtttcaaccat |
52452909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 265
Target Start/End: Original strand, 52452923 - 52452959
Alignment:
| Q |
229 |
gactatgacgacttgacgatgagtacgtccactgaat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| |
|
|
| T |
52452923 |
gactatgacgacttgacgatgagtacgtacgctgaat |
52452959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University