View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20869_low_85 (Length: 279)
Name: NF20869_low_85
Description: NF20869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20869_low_85 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 3 - 260
Target Start/End: Complemental strand, 5214566 - 5214309
Alignment:
| Q |
3 |
aggtcggggaagcaaatatttatcgcctgtgatgctagcaatgaaacatgtccatgtgaataattttttggctaattatcaatttgaagttagacaaaaa |
102 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5214566 |
aggtcggggaagcaaataattatcgcctgtgatgctagtaatgaaacatgtccatgtgaataattttttggctaattatcaatttgaagctagacaaaaa |
5214467 |
T |
|
| Q |
103 |
tgacattattggttaggtaaaatccaatcatagattttgacacctcattgatgagaaaatgccaatcaacatctagctccaacatgccaagtaccaaaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5214466 |
tgacattattggttaggtaaaatccaatcatagattttgacacctcattgataagaaaatgccaatcaacatctagctccaacatgccaagtaccaaaaa |
5214367 |
T |
|
| Q |
203 |
caattatagcccgttggaaattatttcaacggattaccatgtttcttcatgataatga |
260 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5214366 |
caattatagcccgttgaaaattatttcaacggattaccatgtttcttcatgataatga |
5214309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University