View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_high_24 (Length: 323)
Name: NF2086_high_24
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_high_24 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 43807877 - 43807551
Alignment:
| Q |
1 |
cttctacaccatttaggttcgccacaaaatcgtttcgttatttctctctgcaatggcaat----gcatttaactaaaattttctgcatgcaacttcaata |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43807877 |
cttctacaccatttaggttcgccacaaaatcgtttcgttatttccctctgcaatggcaatacatgcatttaactaaaattttctgcatgcaacttcaata |
43807778 |
T |
|
| Q |
97 |
taatcactgttgattttgattttcgtttcaaacgcgctttgcattttcagctgtaaaggttttgtggattttcatctcatatacgagattttgatttcat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43807777 |
taatcactgttgattttgattttcgtttcaaacgcgctttgcattttcagctgtaaaggttttgtggattttcatctcatatacgagattttgatttcat |
43807678 |
T |
|
| Q |
197 |
ctcatatatgcttcattcagttaattttagcttatgtttggttatccggtgagtgaaaaattaattttgattatgtaaaattattccggctaaaagtgag |
296 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43807677 |
ctcataaatgcttcattcagttaatgttagcttatgtttggttatccggtgagtgaaaaattaattttgattatgtaaaattattccggctaaaagtgag |
43807578 |
T |
|
| Q |
297 |
tagaaaagtaaagtatctatcattaac |
323 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43807577 |
tagaaaagtaaagtatctatcattaac |
43807551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University