View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_low_23 (Length: 334)
Name: NF2086_low_23
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 62 - 316
Target Start/End: Original strand, 13669429 - 13669683
Alignment:
| Q |
62 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669429 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
13669528 |
T |
 |
| Q |
162 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgcaatggaaatcaatgattgatgttttcaagttcaagtc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669529 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgcaatggaaatcaatgattgatgttttcaagttcaagtc |
13669628 |
T |
 |
| Q |
262 |
agtgagaagattgacagctattccattgcttgctgctgttaacaatgatattgct |
316 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669629 |
agtgagaagattaacagctattccattgcttgctgctgttaacaatgatattgct |
13669683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University