View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_low_24 (Length: 331)
Name: NF2086_low_24
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 40460327 - 40460519
Alignment:
| Q |
16 |
cagttattttactttgacaatcagaacttgaaagacagttcctagtgtatcttggtaacttttgtttgctgtagataaaaagaaaaattataatgtaatg |
115 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40460327 |
cagtcattttactttgacaaccagaacttgaaagacagttcctagtgtatcttggtaacttttgtttgctgtagataaaaagaaaaattataatgtaatg |
40460426 |
T |
|
| Q |
116 |
ctttggaaatttgattgatttgtgagagtttatagttgacaccgtgaaaaaatcgaatacttttaaatgtgtttggatgttgttttatggtat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40460427 |
ctttggaaatttgattgatttgtgagagtttatagttgacaccgtgaaaaaatcgaatacttttaaatgtgtttggatgttgttttatggtat |
40460519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 222 - 322
Target Start/End: Original strand, 40460547 - 40460644
Alignment:
| Q |
222 |
tttatgggttaacttttgggattgttcttaaaattgtgtgtggaagaggagagtttgacttacttattagtatatcgtttacttaccagtattagtatta |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40460547 |
tttatgggttaacttttgggattgttcttaaaattttgtgtggaagaggagagtttgacttac---ttagtatatcgtttacttaccagtattagtatta |
40460643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 162 - 202
Target Start/End: Complemental strand, 36482740 - 36482700
Alignment:
| Q |
162 |
aaaaaatcgaatacttttaaatgtgtttggatgttgtttta |
202 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
36482740 |
aaaaaatcgaatatttttggatgtgtttggatgttgtttta |
36482700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University