View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_low_34 (Length: 278)
Name: NF2086_low_34
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_low_34 |
 |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0555 (1 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 99)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 17455023 - 17454761
Alignment:
| Q |
1 |
atcaaaaccggagagttcacaaaatatacaaattttgattgtttttaaatccgaaataccgagtttgaaatctaggatcgtctgaacttgatctcacagt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||| | ||| |
|
|
| T |
17455023 |
atcaaaaccggaaagttcacaaaatatacaaattttgattgtttttaaatccaaaataccgagtttggaatctagaatcgtctgaacttgatctaatagt |
17454924 |
T |
 |
| Q |
101 |
cattgatacgttgattgggtgaacgtatagtctct----tacgaggaatcagtatttataatttatttcaatctcactttcacattaaaacataacacca |
196 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| ||| || | ||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17454923 |
cattgatatgttgattgggtgaacgtaaagtctctagactacaagtagtcaatatttataatttatttcaatctcactttcacattaaaccataacacca |
17454824 |
T |
 |
| Q |
197 |
gttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | |||||||||||||||||| ||| |||| |
|
|
| T |
17454823 |
gttgtatccccgtgagcttatctcagttggtagagatattgcatattatatgcaggagtcggg |
17454761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 17433923 - 17433742
Alignment:
| Q |
1 |
atcaaaaccggagagttcacaaaatatacaaattttgattgtttttaaatccgaaataccgagtttgaaatctaggatcgtctgaacttgatctcacagt |
100 |
Q |
| |
|
||||||| || ||| |||| |||||| ||| ||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||| || || |
|
|
| T |
17433923 |
atcaaaatcgaagaattcataaaatacacatattttgattgtttttaaatccaaaataccgagtttggaatctaggattgtctgaacttgatctaacggt |
17433824 |
T |
 |
| Q |
101 |
cattgatacgttgattgggtgaacgtatagtctct----tacgaggaatcagtatttataatttatttcaatctcactttca |
178 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| ||| |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
17433823 |
cattgatatgttgattgggtgaacatatagtctctatactacaaggaatcaacatttataatttgtttcaatctcactttca |
17433742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 10934595 - 10934653
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
10934595 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
10934653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 33573813 - 33573871
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
33573813 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
33573871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 7207841 - 7207898
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
7207841 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
7207898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 17441912 - 17441855
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
17441912 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
17441855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 19953901 - 19953844
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
19953901 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
19953844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 7865429 - 7865371
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
7865429 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
7865371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 9246456 - 9246398
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
9246456 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggg |
9246398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 9435621 - 9435671
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9435621 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
9435671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 15091444 - 15091502
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
15091444 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
15091502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 31802049 - 31802107
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
31802049 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggg |
31802107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 3794246 - 3794189
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
3794246 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggg |
3794189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 7545325 - 7545374
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7545325 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
7545374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 4408355 - 4408403
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4408355 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
4408403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 9372274 - 9372226
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
9372226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 201 - 257
Target Start/End: Original strand, 9704413 - 9704469
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
9704413 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggagccg |
9704469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 607184 - 607231
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
607184 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
607231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 1968992 - 1969050
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||| | |||||| |
|
|
| T |
1968992 |
tatccccgtgagcttagctcagttggtagggatattacatattatatgcaggggccggg |
1969050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 260
Target Start/End: Complemental strand, 28148806 - 28148748
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
28148806 |
atccccttgaacttagctcagttggtagggatattgcatattatatgcaggagccgggt |
28148748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 28237326 - 28237268
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
28237326 |
tatcctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggg |
28237268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 30885644 - 30885598
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30885644 |
tatccccgtgagcttagctcagttggtagggatattgcatattatat |
30885598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 209 - 259
Target Start/End: Complemental strand, 32611620 - 32611570
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
32611570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 6210050 - 6210099
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6210050 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatgca |
6210099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 8439675 - 8439720
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8439675 |
cccgtgagcttagctcagttggtagggatattgcatattatatgca |
8439720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 8857087 - 8857144
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||| | |||||| |
|
|
| T |
8857087 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcaggggccggg |
8857144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 28030860 - 28030909
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28030860 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgca |
28030909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 743565 - 743617
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
743565 |
cgtgagcttagctcagttggtagggatattgcatattagatgcaggagccggg |
743617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 3294765 - 3294809
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcatattatatgca |
3294809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 4661093 - 4661141
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4661093 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgca |
4661141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 13732809 - 13732857
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
13732809 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
13732857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 27094880 - 27094832
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
27094880 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
27094832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 204 - 259
Target Start/End: Original strand, 2251837 - 2251892
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||| | |||||| |
|
|
| T |
2251837 |
ccccgtgagcttagctcagttggtagggatattgcatactatatgcaggggccggg |
2251892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 250
Target Start/End: Original strand, 22574864 - 22574915
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
22574864 |
tgtatccccgtgagcttagctcagttggtagggatatcgcattttatatgca |
22574915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 4869768 - 4869714
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||| | |||||| |
|
|
| T |
4869768 |
cccgtgagcttagctcagttggtagggatactgcatattatatgcaggggccggg |
4869714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 19892349 - 19892303
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
19892349 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
19892303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 29284263 - 29284309
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
29284263 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
29284309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 32050035 - 32049981
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||||||||| |||||||| |
|
|
| T |
32050035 |
cccgtgagcttaactcagctggtagggatattgcatattatatgcaggagccggg |
32049981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 32166369 - 32166423
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
32166369 |
cccgtgagcttagctcaattggtagggatattgcatattatatgcaggggccggg |
32166423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 208 - 257
Target Start/End: Original strand, 361166 - 361215
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
361166 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagccg |
361215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 3640511 - 3640568
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||| |||||||| | |||||| |
|
|
| T |
3640511 |
atcctcgtgagcttagctcagttggtagggatattgcatagtatatgcaagggccggg |
3640568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 7177291 - 7177340
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
7177291 |
tatccccgtgagcttagctcagttggtagggatattgtattttatatgca |
7177340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 10483610 - 10483561
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
10483610 |
tatccccgtgatcttagctcagttggtagggatattgcattttatatgca |
10483561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 10517195 - 10517244
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
10517195 |
tatccccgtgagcttagctcagttggtatggatattgcattttatatgca |
10517244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 19374914 - 19374865
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
19374914 |
tatccccgtgagcttagctcagttagtaggaatattgcatattatatgca |
19374865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 32813723 - 32813666
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| |||||||||| || |||||||||||||||||| | |||||| |
|
|
| T |
32813723 |
atccccgtgagcttagttcagttggtacggatattgcatattatatgcaggggccggg |
32813666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 34432867 - 34432822
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
34432867 |
cccgtgagcttagttcagttggtagggatattgcatattatatgca |
34432822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 978207 - 978159
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
978207 |
atccccgtgagtttagctcagttagtagggatattgcatattatatgca |
978159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 250
Target Start/End: Original strand, 7414331 - 7414374
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
7414331 |
cgtgagcttggctcagttggtagggatattgcatattatatgca |
7414374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 259
Target Start/End: Original strand, 15285546 - 15285597
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| ||| |||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
15285546 |
gtgagtttaactcagttggtagggatattacatattatatgcatgagccggg |
15285597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 3196619 - 3196661
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
3196619 |
cccgtgagcttagctcagttggtagggatattacatattatat |
3196661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 21248529 - 21248575
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
21248529 |
atccccgtaagcttagctcagttggtagggatattgcattttatatg |
21248575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 22997337 - 22997379
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
22997337 |
ccgtgagcttagctcagttggtagggatattgaatattatatg |
22997379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 23791064 - 23791022
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
23791064 |
ccgtgagcttagctcagttggtagggatattgaatattatatg |
23791022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 27218884 - 27218938
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||||||||||| | |||||||| |
|
|
| T |
27218884 |
cccgtgaccttagctcagttgatagggatattgcatattatatgtaggagccggg |
27218938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 30704957 - 30705003
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
30704957 |
atccccgtgagcttagttcagttggtagggatattgcatgttatatg |
30705003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 31935102 - 31935144
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcattttatatgca |
31935144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 216202 - 216251
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
216202 |
tatcccagtgagcttagctcaattggtagggatattgcatgttatatgca |
216251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 259
Target Start/End: Original strand, 492903 - 492956
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||| | || |||||||||||||||||| | |||||| |
|
|
| T |
492903 |
ccgtgagcttagctcagttggcaaggatattgcatattatatgcaggggccggg |
492956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 5052146 - 5052089
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||| |||| ||||||||| ||| |||| |
|
|
| T |
5052146 |
atccccgtgagcttagctcaattggtagggatatcgcattttatatgcaggagtcggg |
5052089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 6419156 - 6419107
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
6419156 |
tatccccgtgagtttaactcagttggtagagatattgcatattatatgca |
6419107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 8297624 - 8297681
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | |||||| ||||||||| | |||||| |
|
|
| T |
8297624 |
atccccgtgagcttagctcaattggtagggatgttgcatgttatatgcaggggccggg |
8297681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 15964009 - 15963968
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatgca |
15963968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 28222863 - 28222908
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
28222863 |
cccgtgaacttaactcagttggtagggatattgcatattatatgca |
28222908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 31104878 - 31104927
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| |||| ||||||||||||| |
|
|
| T |
31104878 |
tatccccgtgagcttagttcagttgatagggatattacatattatatgca |
31104927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 2816887 - 2816935
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
2816887 |
atccccatgagcttagctcaattggtagggatattgcatgttatatgca |
2816935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 3795835 - 3795799
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3795835 |
ttagctcagttggtagggatattgcatattatatgca |
3795799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 7581041 - 7581089
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| || |||||||| |||||||| ||||||||| |
|
|
| T |
7581041 |
atccccgtgagcttagcttagctggtagggatattgcattttatatgca |
7581089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 10628615 - 10628659
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
10628615 |
ccgtgagtttagctcggttggtagggatattgcatattatatgca |
10628659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 12284122 - 12284166
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
12284122 |
ccgtgagcttaactcagttggtagggatattgaatattatatgca |
12284166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 16966455 - 16966419
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16966455 |
ttagctcagttggtagggatattgcatattatatgca |
16966419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 29733625 - 29733673
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||| ||||||||||||| |
|
|
| T |
29733625 |
atccccgtgaacttagctcagttggtacggatattacatattatatgca |
29733673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 33697186 - 33697138
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||||||| ||||||||| |
|
|
| T |
33697186 |
atccccgtgagcttaactcagttgatagggatattgcattttatatgca |
33697138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 2500588 - 2500541
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||| |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
2500588 |
tatctccgtgtgcttagcttagttggtagggatattgcatattatatg |
2500541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 250
Target Start/End: Original strand, 7418280 - 7418323
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
7418280 |
cgtgagcttaactcatttggtagggatattgcatattatatgca |
7418323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 199 - 246
Target Start/End: Complemental strand, 7470805 - 7470758
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
7470805 |
tgtatcctcgtaagcttagctcagttggtagggataatgcatattata |
7470758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 250
Target Start/End: Complemental strand, 10501199 - 10501164
Alignment:
| Q |
215 |
tagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10501199 |
tagctcagttggtagggatattgcatattatatgca |
10501164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Complemental strand, 19618799 - 19618756
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
19618799 |
ccccgtgagtttagctcaattggtagggatattgcatattatat |
19618756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 203 - 250
Target Start/End: Complemental strand, 20568357 - 20568310
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||| |||||||| |
|
|
| T |
20568357 |
tccccgtgagcttagctcagttggtaaggacattgcataatatatgca |
20568310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 21203038 - 21203081
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
21203038 |
cccgtgagtttagctcagttggtagggatattgcatatcatatg |
21203081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 240
Target Start/End: Original strand, 31705896 - 31705934
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
31705896 |
atccccgtgagcttagctcagttggtatggatattgcat |
31705934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 1100309 - 1100264
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
1100309 |
cccgtgaacttagctcagttggtagggatatagcattttatatgca |
1100264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 2688648 - 2688607
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||||||| |
|
|
| T |
2688648 |
ccgttagcttagctcagttggtaaggatattgcatattatat |
2688607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 3299037 - 3298992
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||||||||| ||||||| |
|
|
| T |
3299037 |
cccgtgagcttagatcaattggtagggatattgcatataatatgca |
3298992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Original strand, 7153792 - 7153833
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
7153792 |
tgagcttaactcagttggtagggatattgcatgttatatgca |
7153833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 7328716 - 7328675
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
7328716 |
ccgtgagcttaactcagttggtagggatattgcattttatat |
7328675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 24758735 - 24758784
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||| |||| ||||||||| |
|
|
| T |
24758735 |
tatccccgtgagcttaactcaattggtagggatatcgcattttatatgca |
24758784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 30700257 - 30700216
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
30700257 |
tgagcttaactcagttggtacggatattgcatattatatgca |
30700216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 32837344 - 32837385
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
32837344 |
cgtgagcttagctcagttgctagggatattacatattatatg |
32837385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 1435806 - 1435854
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||| |||||| ||||||| |||| ||||||||||||| |
|
|
| T |
1435806 |
atcctcgtgagcttaactcagtaggtagggatattacatattatatgca |
1435854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 4089988 - 4089952
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
4089988 |
ttagctcagtcggtagggatattgcatattatatgca |
4089952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 259
Target Start/End: Complemental strand, 6658643 - 6658587
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||| |||||||| | |||||| |
|
|
| T |
6658643 |
tccccgtgagcttagcttagttagtagggaaattgcataatatatgcaggggccggg |
6658587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 13158770 - 13158734
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13158770 |
ttagctaagttggtagggatattgcatattatatgca |
13158734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 13163626 - 13163590
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13163626 |
ttagctaagttggtagggatattgcatattatatgca |
13163590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 14579359 - 14579311
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||| | ||||||||| ||||||| |||||||||| |
|
|
| T |
14579359 |
atccccgtgagtttagcttatttggtagggatattgcaaattatatgca |
14579311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 258
Target Start/End: Original strand, 20584070 - 20584126
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
||||| ||||||||| |||||||| ||| | ||||||||||||||| || ||||||| |
|
|
| T |
20584070 |
atccctgtgagcttaactcagttgatagcgatattgcatattatatacaggagccgg |
20584126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 23610388 - 23610344
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | |||||| |
|
|
| T |
23610388 |
ccgtgagcttagctcagttggtagggacattgcataatttatgca |
23610344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 26347403 - 26347447
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||| | ||||| |||||||||| |
|
|
| T |
26347403 |
ccccgtgaacttagctcagttggtagagatattgtatattatatg |
26347447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 238
Target Start/End: Complemental strand, 30391293 - 30391257
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgc |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
30391293 |
atccccgtgagcttagctcagttgttagggatattgc |
30391257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 126)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 198 - 259
Target Start/End: Complemental strand, 6438141 - 6438080
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
6438141 |
ttgtatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
6438080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 1570266 - 1570208
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
1570266 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
1570208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 40519618 - 40519560
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
40519618 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
40519560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 46965736 - 46965794
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
46965736 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
46965794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 15819674 - 15819617
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
15819674 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
15819617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 50899583 - 50899526
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
50899526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 202 - 258
Target Start/End: Complemental strand, 4482671 - 4482615
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
4482671 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgg |
4482615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 204 - 259
Target Start/End: Original strand, 16343027 - 16343082
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
16343027 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
16343082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 259
Target Start/End: Complemental strand, 40375390 - 40375331
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
40375390 |
gtatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggg |
40375331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 1151755 - 1151813
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||| |
|
|
| T |
1151755 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatacaggagccggg |
1151813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 13773164 - 13773222
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
13773164 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggg |
13773222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 22563382 - 22563440
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
22563382 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
22563440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 255
Target Start/End: Original strand, 25999846 - 25999900
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
25999846 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
25999900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 26584820 - 26584762
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
26584820 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggg |
26584762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 43884790 - 43884848
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
43884790 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggg |
43884848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 206 - 259
Target Start/End: Original strand, 2277755 - 2277808
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
2277808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 6702573 - 6702630
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
6702573 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
6702630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 21265653 - 21265710
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
21265653 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
21265710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 32594248 - 32594305
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
32594248 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
32594305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 33207202 - 33207259
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
33207202 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
33207259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 33254725 - 33254782
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
33254782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 33274897 - 33274954
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
33274954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 35605697 - 35605648
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35605697 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
35605648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 197 - 250
Target Start/End: Complemental strand, 42490488 - 42490435
Alignment:
| Q |
197 |
gttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42490488 |
gttggatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
42490435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 3269616 - 3269664
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3269616 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
3269664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 7166300 - 7166252
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
7166252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 8865851 - 8865899
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8865851 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
8865899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 10664867 - 10664819
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10664867 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
10664819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 199 - 259
Target Start/End: Original strand, 18216900 - 18216960
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||| |||||| |||||||| |
|
|
| T |
18216900 |
tgtatccccgtgagcttagctcagttggtagggatattacatattttatgcaagagccggg |
18216960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 206 - 257
Target Start/End: Original strand, 34058215 - 34058266
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
34058215 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccg |
34058266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 2352639 - 2352581
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||| ||| | |||||||||||||||||| |||||||| |
|
|
| T |
2352639 |
tatccccgtgagcttagctcagttgatagagatattgcatattatatgcaggagccggg |
2352581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 6130107 - 6130049
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
6130107 |
tatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggg |
6130049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 256
Target Start/End: Complemental strand, 16526250 - 16526196
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagcc |
256 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
16526250 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcaggagcc |
16526196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 26550490 - 26550548
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
26550490 |
tatccccgtgagcttaactcagttggtagggatattgcatactatatgcaggagccggg |
26550548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 252
Target Start/End: Original strand, 40520827 - 40520877
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatg |
252 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40520827 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcatg |
40520877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 42054330 - 42054376
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42054330 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
42054376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 44732629 - 44732687
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
44732629 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgcaagggccggg |
44732687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 2556552 - 2556601
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2556552 |
tatccccgtaagcttagctcagttggtagggatattgcatattatatgca |
2556601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 6893311 - 6893262
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
6893311 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatgca |
6893262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 9866254 - 9866209
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9866254 |
cccgtgagcttagctcagttggtagggatattgcatattatatgca |
9866209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 18467272 - 18467223
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18467272 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgca |
18467223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 18551706 - 18551649
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||| | |||||| |
|
|
| T |
18551706 |
atccccgtgagcttagctcagttggtatggatattgcatattatatgcaggggccggg |
18551649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 47402737 - 47402688
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
47402737 |
tatccccgtgagcttagctcagctggtagggatattgcatattatatgca |
47402688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 48638528 - 48638577
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
48638528 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatgca |
48638577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 1836500 - 1836548
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
1836500 |
atccccgtgagcttagctcagttggtagggatattacatattatatgca |
1836548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 2754356 - 2754404
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
2754356 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatgc |
2754404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 11215002 - 11215046
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11215002 |
ccgtgagcttagctcagttggtagggatattgcatattatatgca |
11215046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 37662630 - 37662582
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37662630 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgca |
37662582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 51050187 - 51050235
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
51050187 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgca |
51050235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 204 - 259
Target Start/End: Original strand, 27818568 - 27818623
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
27818568 |
ccccctgagcttagctcagttggtagggatattgcatattatattcatgggccggg |
27818623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 8984579 - 8984521
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| ||||||||||| ||||||||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
8984579 |
tatctccgtgagcttaactcagttggcagggatattgcatattatatgcaggagccggg |
8984521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 198 - 255
Target Start/End: Complemental strand, 14760826 - 14760771
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
14760826 |
ttgtatccccgtgagcttagctcagttggta--gatattgcatattatatgcaggagc |
14760771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 255
Target Start/End: Complemental strand, 23545528 - 23545474
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
23545528 |
tatccccgtgagctaagcttagttggtagggatattgcatattatatgcaggagc |
23545474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 255
Target Start/End: Original strand, 29188632 - 29188686
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
29188632 |
tatccccgtgattttagctcagttggtagggatattgcatattatatgcaggagc |
29188686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 46021953 - 46021895
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| ||||||||| |||||| |||||||||||||||||| |||||||| |
|
|
| T |
46021953 |
tatccccgtgagcgtagctcagtaagtagggatattgcatattatatgcaggagccggg |
46021895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 257
Target Start/End: Original strand, 52369599 - 52369649
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
52369599 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccg |
52369649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 7180688 - 7180639
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7180688 |
tatccccgtgaggttagctcagttggtaggaatattgcatattatatgca |
7180639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 12502327 - 12502270
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
12502327 |
atccccgtaagcatagctcagttggtagggatattgcatattatatgcaggagtcggg |
12502270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 258
Target Start/End: Original strand, 15775739 - 15775792
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
|||||||||||| |||| ||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
15775739 |
cccgtgagcttaactcaattggtagggatattgcatattatatgcaggagccgg |
15775792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 19011351 - 19011400
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
19011351 |
tatctccgtgagcttagctcaattggtagggatattgcatattatatgca |
19011400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 32556999 - 32556954
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
32556999 |
cccgtgagcttagctcagctggtagggatattgcatattatatgca |
32556954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 8415726 - 8415774
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
8415726 |
atccacgtgagcttagctcagttcgtagggatattgcatattatatgca |
8415774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 209 - 257
Target Start/End: Complemental strand, 46161189 - 46161141
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
46161189 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggagccg |
46161141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 52426982 - 52426938
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
52426982 |
ccgtgagcttagctcagttgatagggatattgcatattatatgca |
52426938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 259
Target Start/End: Complemental strand, 3694982 - 3694931
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||| | |||||||| |
|
|
| T |
3694982 |
gtgagcttagctcagttggaagggatattgcatattatatgtaggagccggg |
3694931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 24874971 - 24875018
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatg |
252 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| | |||||||| |
|
|
| T |
24874971 |
cccgtgagcttagctcagttggtagggatattgcataatttatgcatg |
24875018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 42299581 - 42299538
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
42299581 |
cgtgagcttagttcagttggtagggatattgcatattatatgca |
42299538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 16182199 - 16182245
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatg |
252 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
16182199 |
ccgtgagcttagctgagttggtagagatattgcatattatatgcatg |
16182245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 18534002 - 18534044
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
18534002 |
ccgtgagcttagctcagttggtagagatattgcatattatatg |
18534044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 255
Target Start/End: Complemental strand, 34580860 - 34580806
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||| | |||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
34580860 |
tatccccgtgagttcagctcagttggtagggatattgtatattatatgcaggagc |
34580806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 46225390 - 46225432
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatgca |
46225432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 47478921 - 47478875
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
47478921 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatg |
47478875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 6463109 - 6463052
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| || ||||||||| | |||||| |
|
|
| T |
6463109 |
atccccatgagcttagctcagttggtagggatattgtattttatatgcaggggccggg |
6463052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 7191028 - 7191077
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
7191028 |
tatctccgtgaccttagctcagttgatagggatattgcatattatatgca |
7191077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 12404352 - 12404401
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
12404352 |
tatccccgtgagattagatcaattggtagggatattgcatattatatgca |
12404401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 13538519 - 13538462
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||| ||||| ||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
13538519 |
atcccagtgaacttagttcagttggtagggatattgcatattatatgcaggggccggg |
13538462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 15390220 - 15390265
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
15390220 |
cccgtgagcttaactcagttggtagggatattgcatattagatgca |
15390265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 42848797 - 42848756
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
42848797 |
tgagcttagctcagttgatagggatattgcatattatatgca |
42848756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 43668030 - 43667973
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| |||||||||||||| |||| | |||||||||||||||||| || ||||| |
|
|
| T |
43668030 |
atccccgtaagcttagctcagttcgtagagatattgcatattatatgcaggaaccggg |
43667973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 44019272 - 44019321
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
44019272 |
tatctccgtgagcttagctcagttgatagggatattgcattttatatgca |
44019321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 209 - 250
Target Start/End: Original strand, 51933510 - 51933551
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatgca |
51933551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 199 - 259
Target Start/End: Complemental strand, 30471 - 30411
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| |||| |||||| |||||| |||||||| ||||||||| |||||||| |
|
|
| T |
30471 |
tgtatccccgtgaacttaattcagttagtagggatattgcattttatatgcaggagccggg |
30411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 4553619 - 4553571
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
4553619 |
atccccgtgagcttaactcagttggtagaaatattgcatattatatgca |
4553571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 5190854 - 5190806
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
5190854 |
atccccatgagcttagctcaattggtagggatatcgcatattatatgca |
5190806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 207 - 259
Target Start/End: Complemental strand, 6712177 - 6712125
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
6712177 |
cgtgagcttagctcagttggtaggtatattgcattttatatgcaggggccggg |
6712125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 11065117 - 11065165
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||| || ||| | |||||||||||||||||| |
|
|
| T |
11065117 |
atccccgtgagcttagctcagatgatagagatattgcatattatatgca |
11065165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 15595726 - 15595770
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
15595726 |
ccgtgagcttagctcagttggtagggacattgcataatatatgca |
15595770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 17671483 - 17671435
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| | ||||||| |
|
|
| T |
17671483 |
atccccgtgagcttagctcagttggtagggatatcgcatttcatatgca |
17671435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 27650694 - 27650742
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
27650694 |
atcctcgtgagctaagttcagttggtagggatattgcatattatatgca |
27650742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 33033127 - 33033171
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
33033127 |
ccgtgagcttaattcagttggtagggatattgcatattatatgca |
33033171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 34271841 - 34271889
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||| |||||||| |||| ||||||||||||| |
|
|
| T |
34271841 |
atccccgtgagtttagctcagctggtagggatattacatattatatgca |
34271889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 45271763 - 45271811
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| | ||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
45271763 |
atccccgttaacttagttcagttggtagggatattgcatattatatgca |
45271811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 242
Target Start/End: Complemental strand, 45333784 - 45333744
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatat |
242 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
45333784 |
atccccgtgagcttagctcagttggcagggatattgcatat |
45333744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 48897190 - 48897142
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||||||| |
|
|
| T |
48897190 |
atccccgtgagcttaactcatttggtaggaatattgcatattatatgca |
48897142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 199 - 250
Target Start/End: Complemental strand, 923180 - 923129
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||||||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
923180 |
tgtattcccgtgaatttagcgcagttggtagggatattgcatattatatgca |
923129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 203 - 250
Target Start/End: Complemental strand, 12650456 - 12650409
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
12650456 |
tccccgtgaacttagctcagttggtaaggatattgcatgttatatgca |
12650409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 258
Target Start/End: Complemental strand, 16313774 - 16313723
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
|||||||||| |||| |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
16313774 |
cgtgagcttaactcaattggtaggaatattgcatattatatgcaggagccgg |
16313723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 25034904 - 25034947
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
25034904 |
cccgtgagcttagctcagttggtaggaatattgcattttatatg |
25034947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 206 - 249
Target Start/End: Original strand, 25580689 - 25580732
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
25580689 |
ccgtgagcttaactcagttggtagagatattgcatattatatgc |
25580732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 27344475 - 27344522
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27344475 |
tatcctcgtgagcttagctcagttggtagacatattgcatattatatg |
27344522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 211 - 250
Target Start/End: Complemental strand, 27642790 - 27642751
Alignment:
| Q |
211 |
agcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
27642790 |
agcttagctcagttggtagggatattgcattttatatgca |
27642751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 259
Target Start/End: Complemental strand, 36666647 - 36666592
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| | |||||| | |||||| |
|
|
| T |
36666647 |
ccccgtgagcttagctcagttggtagggacattgcataatttatgcaggggccggg |
36666592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 250
Target Start/End: Complemental strand, 47930731 - 47930696
Alignment:
| Q |
215 |
tagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47930731 |
tagctcagttggtagggatattgcatattatatgca |
47930696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 17580320 - 17580362
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
17580320 |
gtgaacttagctcagttggtagggatattgcatgttatatgca |
17580362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 28867480 - 28867522
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
28867480 |
ccgtgaacttagctcagttggtaggaatattgcatattatatg |
28867522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 257
Target Start/End: Original strand, 29204647 - 29204697
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | |||||| |||||| |
|
|
| T |
29204647 |
cgtgagcttagctcagttggtagggacattgcataatttatgcaagagccg |
29204697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 31762070 - 31762024
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||| ||||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
31762070 |
tatcccagtgagcttagctcagttggcagtgatattgcatattatat |
31762024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 259
Target Start/End: Original strand, 31818598 - 31818648
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
31818598 |
tgagcttagttcagttgctaggaatattgcatattatatgcaggagccggg |
31818648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 39347052 - 39346995
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||| |||||||| | |||||||| ||||||||| |||||||| |
|
|
| T |
39347052 |
tatccccgtgagcttagcttagttggta-gtatattgcattttatatgcaggagccggg |
39346995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 49253609 - 49253654
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
49253609 |
ccccgtgagcttagctaagttggta-ggatattgcatattatatgca |
49253654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 255
Target Start/End: Complemental strand, 50824472 - 50824430
Alignment:
| Q |
213 |
cttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
50824472 |
cttagttcagttggtagggatattgcatattatatgcaggagc |
50824430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 14349646 - 14349687
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||||||| |
|
|
| T |
14349646 |
cgtgaacttagctcagttggtagagatattgcatattatatg |
14349687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 19924428 - 19924485
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||| |||| ||||||||| ||| |||| |
|
|
| T |
19924428 |
atccccgtgatcttaactcagttggtagggatatcgcattttatatgcaagagtcggg |
19924485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 231
Target Start/End: Complemental strand, 23933141 - 23933112
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23933141 |
atccccgtgagcttagctcagttggtaggg |
23933112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 250
Target Start/End: Original strand, 24253780 - 24253817
Alignment:
| Q |
213 |
cttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
24253780 |
cttagctcatttggtagggatattgcatattatatgca |
24253817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 37626231 - 37626182
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| || ||||||||| |
|
|
| T |
37626231 |
tatccccgtgagcttacctcagttggtagggatattatattttatatgca |
37626182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 42550079 - 42550034
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| | ||||||| |||||||||||| ||||| |
|
|
| T |
42550079 |
cccgtgagcttagctcaatcggtagggatattgcatattacatgca |
42550034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 45517337 - 45517296
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| |||||| |
|
|
| T |
45517337 |
ccgtgagcttagttcagttggtagggatattgcattttatat |
45517296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 10851821 - 10851869
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||||| |||||| || ||||| |||||||||||| |
|
|
| T |
10851821 |
atcctcgtgagcttagctcaattggtaaggatattgtatattatatgca |
10851869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 17776837 - 17776885
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| |||| ||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
17776837 |
atccccatgagtttagctcagttggtaggcatattgcattttatatgca |
17776885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 257
Target Start/End: Complemental strand, 31401315 - 31401263
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| | |||||| |||||| |
|
|
| T |
31401315 |
cccgtgagcttagctcagttgatagggacattgcataatttatgcaggagccg |
31401263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Original strand, 33200036 - 33200064
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33200036 |
tccccgtgagcttagctcagttggtaggg |
33200064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 36314052 - 36314004
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| | ||| ||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
36314052 |
atccccattagcatagctcagttggtagggatattgcatattatttgca |
36314004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 38032201 - 38032249
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| ||||| |||| |||||||| ||||||||||| |||||| |
|
|
| T |
38032201 |
atccccgtgaacttagatcagctggtagggatattgcatattgtatgca |
38032249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 250
Target Start/End: Original strand, 40634214 - 40634246
Alignment:
| Q |
218 |
ctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
40634214 |
ctcagttggtagggatattgcatattatatgca |
40634246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 41709992 - 41709948
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| | ||||||||| |
|
|
| T |
41709992 |
ccgtgagcttagcttagttggtagggatattgcgtgttatatgca |
41709948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 119)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 201 - 260
Target Start/End: Original strand, 1743123 - 1743182
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
1743123 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggt |
1743182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 200 - 259
Target Start/End: Complemental strand, 4417760 - 4417701
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
4417760 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
4417701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 9835030 - 9835087
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
9835087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 12463753 - 12463810
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
12463753 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
12463810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 32505685 - 32505742
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
32505685 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
32505742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 41179876 - 41179819
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
41179876 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
41179819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 259
Target Start/End: Original strand, 2848208 - 2848267
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
2848208 |
gtatccccgtgagcttagctcagttggtagggatattgtatattatatgcatgaggcggg |
2848267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 259
Target Start/End: Original strand, 27765252 - 27765311
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
27765252 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggg |
27765311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 8968745 - 8968803
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
8968745 |
tatctccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
8968803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 11897244 - 11897302
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
11897244 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
11897302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 16603394 - 16603452
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
16603394 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagaagccggg |
16603452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 17545246 - 17545188
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
17545246 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
17545188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 25648159 - 25648101
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
25648159 |
tatccccgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggg |
25648101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 35515512 - 35515566
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
35515512 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
35515566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 39919167 - 39919109
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
39919167 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggg |
39919109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 2328589 - 2328646
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
2328589 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggg |
2328646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 5966826 - 5966883
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
5966826 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggg |
5966883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 255
Target Start/End: Complemental strand, 6518849 - 6518796
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
6518849 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
6518796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 21918049 - 21918102
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
21918102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 42320313 - 42320362
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42320313 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
42320362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 42525397 - 42525454
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
42525397 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggg |
42525454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 258
Target Start/End: Original strand, 12767961 - 12768017
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
12767961 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggagccgg |
12768017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 259
Target Start/End: Complemental strand, 4745947 - 4745892
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| | |||||||| |
|
|
| T |
4745947 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgaaggagccggg |
4745892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 200 - 259
Target Start/End: Complemental strand, 11774534 - 11774475
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| |||||||||||||||||| |||||||| |
|
|
| T |
11774534 |
gtatccccgtgaccttagctcagtttgtagggatattgcatattatatgcaggagccggg |
11774475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 12891553 - 12891600
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12891553 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
12891600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 202 - 257
Target Start/End: Original strand, 40091474 - 40091529
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
40091474 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaagagccg |
40091529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 260
Target Start/End: Original strand, 5900289 - 5900347
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| | ||||||| |
|
|
| T |
5900289 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggggccgggt |
5900347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 13622020 - 13621962
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||| | |||||| |
|
|
| T |
13622020 |
tatccccgtgagcttagctcagttggtagggatatcgcatattatatgcaggggccggg |
13621962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 204 - 250
Target Start/End: Complemental strand, 25472654 - 25472608
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25472654 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgca |
25472608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 43580878 - 43580932
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
43580878 |
cccgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggg |
43580932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 6558797 - 6558846
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
6558797 |
tatccccgtgagcttagctcaattggtagggatattgcatattatatgca |
6558846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 8241046 - 8241095
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8241046 |
tatccccatgagcttagctcagttggtagggatattgcatattatatgca |
8241095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 9125659 - 9125708
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
9125659 |
tatccccgtgagcttagctcagttggtagcgatattgcatattatatgca |
9125708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 18815345 - 18815402
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||| | |||||| |
|
|
| T |
18815345 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcaggcgccggg |
18815402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 32706319 - 32706376
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||| | |||||||| |
|
|
| T |
32706319 |
atccccgtgagcttagctcagttggtagggatattacatattatatggaggagccggg |
32706376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 36888468 - 36888411
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
36888468 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggg |
36888411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 21749450 - 21749402
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
21749450 |
atccccgtgagcttagctcagttggtagggatactgcatattatatgca |
21749402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 29713449 - 29713401
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
29713449 |
atccccgtgagcttagctcagttggtagggatattgcctattatatgca |
29713401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 259
Target Start/End: Complemental strand, 25400434 - 25400383
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcatattatatgcaggagccggg |
25400383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 256
Target Start/End: Original strand, 27798617 - 27798672
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagcc |
256 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
27798617 |
tatccctgtgagcatagctcagttggtagggatattgcatattatatgcaagagcc |
27798672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 39886286 - 39886239
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
39886286 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatg |
39886239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 14641179 - 14641125
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||| ||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
14641179 |
cccgtgagcttaactcaattggtagggatattgcatattatatgcaggagccggg |
14641125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 209 - 255
Target Start/End: Complemental strand, 16386807 - 16386761
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagc |
16386761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 42916385 - 42916443
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || ||||||||| | |||||| |
|
|
| T |
42916385 |
tatccccgtgagcttagctcagttggtagggatattgtatgttatatgcaggggccggg |
42916443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 8478967 - 8478918
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
8478967 |
tatccccgtgagtttagttcagttggtagggatattgcatattatatgca |
8478918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 17666006 - 17666051
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17666006 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgca |
17666051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 23292487 - 23292442
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
23292487 |
cccgtgagcttagctcagttggtagggatattgcatgttatatgca |
23292442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 24033074 - 24033131
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
24033074 |
atccccgcgagcttagctcagttggtagggatattgcattttatatgcaggggccggg |
24033131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 25729514 - 25729465
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
25729514 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgca |
25729465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 33736088 - 33736039
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
33736088 |
tatccccgggagcttaactcagttggtagggatattgcatattatatgca |
33736039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 41477432 - 41477383
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
41477432 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgca |
41477383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 546803 - 546847
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
546803 |
ccgtgagcttaactcagttggtagggatattgcatattatatgca |
546847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 831589 - 831637
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
831589 |
atccccgtgagcttagctctgttggtagggatatttcatattatatgca |
831637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 1269240 - 1269192
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
1269240 |
atccccgtgagcttagctcaattggtagagatattgcatattatatgca |
1269192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 10241726 - 10241770
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
10241726 |
ccgtgagcttaactcagttggtagggatattgcatattatatgca |
10241770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 15241393 - 15241441
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
15241393 |
atccccgtgagcttagctcagttgataggaatattgcatattatatgca |
15241441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 208 - 260
Target Start/End: Original strand, 29154846 - 29154898
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| | ||||||||| |
|
|
| T |
29154846 |
gtgagcttagctcagttggtagggatagtgcatattatatgtaggagccgggt |
29154898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 40361648 - 40361604
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40361648 |
ccgtgagtttagctcagttggtagggatattgcatattatatgca |
40361604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 250
Target Start/End: Original strand, 2362971 - 2363014
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
2362971 |
cgtgagcttaactcagttggtagggatattgcatattatatgca |
2363014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 3198325 - 3198372
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
3198325 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgca |
3198372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 250
Target Start/End: Original strand, 6414070 - 6414113
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
6414070 |
cgtgagcttaactcagttggtagggatattgcatattatatgca |
6414113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 214 - 257
Target Start/End: Original strand, 28308243 - 28308286
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
28308243 |
ttagctcagttggtagggatattgcatattatatgcaagagccg |
28308286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 988711 - 988765
Alignment:
| Q |
202 |
atccccgtgagcttagctcagtt-ggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
988711 |
atccccgtgagcttaactcagtttggtagggatattgcatattatatgcaggagc |
988765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 204 - 250
Target Start/End: Complemental strand, 11188753 - 11188707
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
11188753 |
ccccgtgagcttagctcagttgataggaatattgcatattatatgca |
11188707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 11786135 - 11786085
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
11786135 |
gtatctccgtgagcttaactcagttggtagggatattgcattttatatgca |
11786085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 246
Target Start/End: Original strand, 16971617 - 16971663
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||| |||||||| |
|
|
| T |
16971617 |
gtatccccgtgagcttagctcagttggtagagatattgtatattata |
16971663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 26912830 - 26912876
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
26912830 |
atccccgtgagcttaactcaattggtagggatattgcatattatatg |
26912876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 35113037 - 35112987
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
35113037 |
gtattcccgtgagcttagttcagttgatagggatattgcatattatatgca |
35112987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 255
Target Start/End: Original strand, 39165013 - 39165067
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
39165013 |
tatctccgtgagtttagttcagttggtagggatattgcatattatatgcaggagc |
39165067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 209 - 259
Target Start/End: Original strand, 41156332 - 41156382
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
41156332 |
tgagcttagctcggttgatagggatattgcatattatatgcaggagccggg |
41156382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 3712140 - 3712091
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
3712140 |
tatccccgtaagcttagctcagttggtagagatattgcattttatatgca |
3712091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 6526046 - 6526095
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
6526046 |
tatccccgtgagtttagctcagttggtagagatattggatattatatgca |
6526095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 8750971 - 8750926
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| | ||||||||||| |||||||||||||||||| |
|
|
| T |
8750971 |
cccgtgagcttagttaagttggtagggatattgcatattatatgca |
8750926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 17064932 - 17064883
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||||||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
17064932 |
tatcctcgtgagcttaactcaattggtagggatattgcatattatatgca |
17064883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 19985500 - 19985545
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
19985500 |
cccgtgaccttagctcagttggtagggatattgcataatatatgca |
19985545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 21962178 - 21962121
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| ||||||||| |||| ||||||| ||||||||| |||||||| |
|
|
| T |
21962178 |
atccccgtgagcttaactcagttggcagggatattgcaaattatatgcgggagccggg |
21962121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 22569317 - 22569272
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22569317 |
atccctgtgagcttagctcagttggtaggcatattgcatattatat |
22569272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 31074200 - 31074143
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||| ||| ||||||| | |||||||| |
|
|
| T |
31074200 |
atccccgtgagcttaactcagttggtagggatattacattttatatgtaggagccggg |
31074143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 36124395 - 36124444
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
36124395 |
tatctccgtgagcttagctcagttgataggaatattgcatattatatgca |
36124444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 258
Target Start/End: Original strand, 37034802 - 37034859
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| ||| |||| ||||||||| ||||||| |
|
|
| T |
37034802 |
tatccccatgagcttagctcaattggtagggatatcgcattttatatgcaggagccgg |
37034859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 259
Target Start/End: Original strand, 10404133 - 10404181
Alignment:
| Q |
211 |
agcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
10404133 |
agcttagctcagttggtaggaatattgcatattatatgcaggagtcggg |
10404181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 16891348 - 16891388
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
16891348 |
cgtgagcttagctcagttggtagggatattgcattttatat |
16891388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 24132934 - 24132982
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| ||| | |||||| ||||||||||| |
|
|
| T |
24132934 |
atccccgtgagcttagctcagttgatagagatattgcgtattatatgca |
24132982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 32423562 - 32423610
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||| |||||||||||| |
|
|
| T |
32423562 |
atccccgtgagcttaactcagttgttagggatattgtatattatatgca |
32423610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 35241397 - 35241441
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
35241397 |
ccgtgagcttagttcagttggtagagatattgcatattatatgca |
35241441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 40081875 - 40081923
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||| ||| ||||||||| |
|
|
| T |
40081875 |
atccccgtgagcttagctcagttggtagagatattacatcttatatgca |
40081923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 4067980 - 4068027
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
4067980 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgca |
4068027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 20719734 - 20719781
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||||||| ||||||| |
|
|
| T |
20719734 |
tatccccgtgagcttagatctgttggtagggatattgcattttatatg |
20719781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 250
Target Start/End: Original strand, 30571164 - 30571199
Alignment:
| Q |
215 |
tagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30571164 |
tagctcagttggtagggatattgcatattatatgca |
30571199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 39028101 - 39028058
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
39028101 |
cgtgagattagctcatttggtagggatattgcatattatatgca |
39028058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 40276510 - 40276467
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40276510 |
cgtgagtttagctcagttggtaggaatattgcatattatatgca |
40276467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 1469726 - 1469768
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||||||||||||||| | |||||||||||||||| |
|
|
| T |
1469726 |
ccgtgagtttagctcagttggtagagatattgcatattatatg |
1469768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 4393851 - 4393901
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||||||||||| ||||||||||||| | |||||| ||||||||| |
|
|
| T |
4393851 |
gtatctccgtgagcttagttcagttggtagggatgttgcattttatatgca |
4393901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 6119866 - 6119908
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
6119866 |
gtgagcttagctcagttggaagggatattgcattttatatgca |
6119908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 11017168 - 11017218
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| |||||| |||||||||||||||||| || |||||| |||||||| |
|
|
| T |
11017168 |
gtatccgcgtgagtttagctcagttggtagggataatgcataatatatgca |
11017218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 11146602 - 11146556
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| || || |||||||| ||||||| |
|
|
| T |
11146602 |
atccccgtgagcttagctcagttgataaggatattgcatgttatatg |
11146556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 231
Target Start/End: Original strand, 13956898 - 13956928
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13956898 |
tatccccgtgagcttagctcagttggtaggg |
13956928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 18638594 - 18638652
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| ||| |||| ||||||||| | |||||| |
|
|
| T |
18638594 |
tatcgccgggagcttagctcagttggtagggatatcgcattttatatgcaggggccggg |
18638652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 18928723 - 18928765
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
18928723 |
gtgagcttagctcagttggtagggatattgcataatttatgca |
18928765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 244
Target Start/End: Complemental strand, 18993534 - 18993492
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| ||||||| |
|
|
| T |
18993534 |
atccccgtgagcttagctcagttgatagggatattacatatta |
18993492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 29045890 - 29045932
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
29045890 |
gtgagtttagttcagttggtagggatattgcatattatatgca |
29045932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 42158882 - 42158924
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
42158882 |
cccgtgaacttagctcagtttgtagggatattgcatattatat |
42158924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 42885830 - 42885872
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
42885830 |
ccgtgagcttagctaagttggtagagatattgcatattatatg |
42885872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 1670394 - 1670439
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
1670394 |
cccgtgagcttatatcagttggtagggatatggcatattatatgca |
1670439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 17175124 - 17175067
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| |||| ||| |||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
17175124 |
atccccatgagtttaactcagttggtagggatattgcatgttatatgcaggggccggg |
17175067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 19891500 - 19891451
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||||||||| ||||||||||| || |||||||| ||||||||| |
|
|
| T |
19891500 |
tatcctcgtgagcttaactcagttggtaaggatattgcattttatatgca |
19891451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 24477825 - 24477870
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
24477825 |
cccgtgagcttagctcagttggtagggacgttgcataatatatgca |
24477870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 33433992 - 33433947
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
33433992 |
atccccgtgaacttagctcagttggtagaaatattgcatattatat |
33433947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 36716924 - 36716883
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatgca |
36716883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 39780802 - 39780851
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||| |||||||| ||||||||| |
|
|
| T |
39780802 |
tatccccgtgagcgtagctcaattgctagggatattgcattttatatgca |
39780851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 217 - 250
Target Start/End: Complemental strand, 42718879 - 42718846
Alignment:
| Q |
217 |
gctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
42718879 |
gctcagttggtagggatattgcatattatatgca |
42718846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 42842945 - 42842904
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| ||||||||| |
|
|
| T |
42842945 |
ccgtgagcttagctcagttggtagagatattgtatattatat |
42842904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 9688745 - 9688697
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| |||| |||| |||||||||||||||||| |
|
|
| T |
9688745 |
atccccgtgagcttagcttagtttgtagaaatattgcatattatatgca |
9688697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 18049691 - 18049655
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
18049691 |
cccgtgagcttagctcaattggtagggatattgcata |
18049655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 19273273 - 19273218
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
19273273 |
tatccccgtgagc---gctcagttggtagggatattgcatgttatatgcaggggccggg |
19273218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 247
Target Start/End: Complemental strand, 20370192 - 20370152
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
20370192 |
cgtgagcttagctcagttggtagggataatgcataatatat |
20370152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 27241642 - 27241686
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
27241642 |
ccgtgagcttagctcagtttgtaggaatattacatattatatgca |
27241686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 34436850 - 34436902
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||||| | |||||| |
|
|
| T |
34436850 |
cgtgagcttagctcagttggtagggacaatgcataatatatgcaagggccggg |
34436902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 35512030 - 35511982
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||| |||||||| |
|
|
| T |
35512030 |
tatccccgtgagcttaactcagttggtagggatatcacattttatatgc |
35511982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 7e-21; HSPs: 147)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 201 - 260
Target Start/End: Original strand, 26868345 - 26868404
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
26868345 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggt |
26868404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 200 - 259
Target Start/End: Original strand, 43596890 - 43596949
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
43596890 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
43596949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 46775104 - 46775046
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
46775104 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
46775046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 3847678 - 3847735
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
3847735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 6371111 - 6371168
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
6371168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 43147457 - 43147400
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
43147457 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
43147400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 46105532 - 46105589
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
46105532 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
46105589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 55251424 - 55251367
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
55251424 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
55251367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 4234359 - 4234301
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
4234359 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggagccggg |
4234301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 22230504 - 22230450
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
22230504 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
22230450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 255
Target Start/End: Complemental strand, 26919542 - 26919488
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
26919542 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
26919488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 49901478 - 49901536
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
49901478 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
49901536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 8965091 - 8965148
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
8965091 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
8965148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 39023171 - 39023220
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39023171 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
39023220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 43207666 - 43207719
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
43207666 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
43207719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 45112184 - 45112127
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
45112184 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcaggagccggg |
45112127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 198 - 255
Target Start/End: Original strand, 45126125 - 45126182
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
45126125 |
ttgtatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggagc |
45126182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 48569250 - 48569201
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48569250 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
48569201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 198 - 259
Target Start/End: Complemental strand, 55238576 - 55238515
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
55238576 |
ttgtatccccgtgagcttagcttagttggtagggatattgcatattatatgcaggggccggg |
55238515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 199 - 259
Target Start/End: Complemental strand, 11375965 - 11375905
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||| | |||||| |
|
|
| T |
11375965 |
tgtatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggg |
11375905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 24680159 - 24680111
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
24680111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 37935858 - 37935906
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
37935906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 198 - 257
Target Start/End: Original strand, 46582627 - 46582686
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
46582627 |
ttgtatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagccg |
46582686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 40051619 - 40051665
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40051619 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
40051665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 260
Target Start/End: Original strand, 55536377 - 55536435
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||| |||| |||| |
|
|
| T |
55536377 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcaggagcggggt |
55536435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 637096 - 637153
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||| |
|
|
| T |
637096 |
atccccgtgagcttagctcagctggtaggaatattgcatattatatgcaggagccggg |
637153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 1458091 - 1458034
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
1458091 |
atccccgtaagcttagctcagttgatagggatattgcatattatatgcaggagccggg |
1458034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 4958629 - 4958572
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
4958629 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggg |
4958572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 8433696 - 8433651
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8433696 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
8433651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 9761112 - 9761165
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
9761112 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcaggagc |
9761165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 22788744 - 22788699
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22788744 |
cccgtgagcttagctcagttggtagggatattgcatattatatgca |
22788699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 255
Target Start/End: Complemental strand, 23705226 - 23705173
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
23705226 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcaggagc |
23705173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 43978008 - 43978053
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43978008 |
cccgtgagcttagctcagttggtagggatattgcatattatatgca |
43978053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 44602482 - 44602539
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
44602482 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggg |
44602539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 45849043 - 45849092
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
45849043 |
tatccccgtgagcttagctcagttggtagggatattgcatattttatgca |
45849092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 47934145 - 47934088
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||| | |||||| |
|
|
| T |
47934145 |
atccccgtgagcttagctcagttggtagggatatggcatattatatgcaggggccggg |
47934088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 49757357 - 49757300
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
49757357 |
atccccgtgagcatagctcagttggtaggaatattgcatattatatgcaggagccggg |
49757300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 52798274 - 52798323
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
52798274 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgca |
52798323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 55853182 - 55853133
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
55853182 |
tatccccgtgagcttagctcagttggtagagatattgcatattatatgca |
55853133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 3036128 - 3036080
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
3036128 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
3036080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 3764081 - 3764033
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
3764081 |
atccccgtgagcttagctcagttggtagggatattacatattatatgca |
3764033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 25235870 - 25235822
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25235870 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgca |
25235822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 30217600 - 30217644
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30217600 |
ccgtgagcttagctcagttggtagggatattgcatattatatgca |
30217644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 31852688 - 31852640
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
31852688 |
gtatccccgtgagcttatctcagttggtagggttattgcatattatatg |
31852640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 34353780 - 34353824
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34353780 |
ccgtgagcttagctcagttggtagggatattgcatattatatgca |
34353824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 203 - 259
Target Start/End: Original strand, 37251111 - 37251167
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| |||||| |||||||| |
|
|
| T |
37251111 |
tccccgtgagcttaactcagttggtagggatattgcatattttatgcaggagccggg |
37251167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 51512083 - 51512035
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
51512083 |
tatccccgtgagctgagctcagttggtagggatattgcatattatatgc |
51512035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 244
Target Start/End: Complemental strand, 35219574 - 35219531
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35219574 |
tatccccgtgagcttagctcagttggtagggatattgcatatta |
35219531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 40994173 - 40994130
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40994173 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
40994130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 255
Target Start/End: Original strand, 3815060 - 3815110
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
3815060 |
cccgtgagcttagcttagttggtagggatattgcatattatatgcaggagc |
3815110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 4590242 - 4590288
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
4590242 |
tatccccgtgagtttagctcagttggtagggatattgcatattatat |
4590288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 5165853 - 5165911
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||||||||||||| | |||||| |
|
|
| T |
5165853 |
tatccccgtgagcttaactcagttggtagggatatcgcatattatatgcaggggccggg |
5165911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 7686336 - 7686278
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| ||||||||| | |||||| |
|
|
| T |
7686336 |
tatccccgtgagcttagctcagttggtagagatattgcattttatatgcaggggccggg |
7686278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 42231512 - 42231566
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
42231512 |
cccgtgagcttaactcagttggtaggaatattgcatattatatgcaggagccggg |
42231566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 3157291 - 3157242
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3157291 |
tatccccgtgaacttagctcagttggtaggaatattgcatattatatgca |
3157242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 5179955 - 5179898
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||| |||| ||||||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
5179955 |
atccccgtgaacttaactcagttggtaaggatattgcatattatatgcaggagccggg |
5179898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 13264348 - 13264299
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
13264348 |
tatccccatgagcttcgctcagttggtagggatattgcatattatatgca |
13264299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 21935474 - 21935531
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
21935474 |
atccccgcaagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
21935531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 258
Target Start/End: Complemental strand, 23787413 - 23787356
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
|||||| |||||| || |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
23787413 |
tatccctgtgagcataactcagttggtagggatattgcatattatatgcaggagccgg |
23787356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 27743778 - 27743733
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27743778 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgca |
27743733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 35465432 - 35465477
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
35465432 |
atccccgtgagcttagctcagttggtagggatattgcattttatat |
35465477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 39696405 - 39696364
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39696405 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
39696364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 39697932 - 39697887
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
39697932 |
cccgtgagcttagctcagttgatagggatattgcatattatatgca |
39697887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 246
Target Start/End: Original strand, 42218746 - 42218791
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
42218746 |
tatccccgtgaacttagctcagttggtagggatattgcatattata |
42218791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 197 - 250
Target Start/End: Original strand, 45673644 - 45673697
Alignment:
| Q |
197 |
gttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
45673644 |
gttgcatccccgtgagcttaactcagttggtaggaatattgcatattatatgca |
45673697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 49447118 - 49447175
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| |||||||||||||||||||| || |||||||||||||||| | |||||||| |
|
|
| T |
49447118 |
atccccatgagcttagctcagttggtaaggatattgcatattatatgtaggagccggg |
49447175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 50457784 - 50457739
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
50457784 |
cccgtgagcttagctcagttggtaaggatattgcatattatatgca |
50457739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 52757352 - 52757303
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
52757352 |
tatccccgtgagcttagctcagttggcaggaatattgcatattatatgca |
52757303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 259
Target Start/End: Complemental strand, 53572396 - 53572343
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
53572396 |
ccgtgagcttaactcagttgatagggatattgcatattatatgcaggagccggg |
53572343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 10402438 - 10402486
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
10402438 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgca |
10402486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 10417294 - 10417246
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
10417294 |
atccccatgagcttagctcagttggtagggatattacatattatatgca |
10417246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 12504716 - 12504668
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
12504716 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatgca |
12504668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 13578534 - 13578490
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
13578534 |
ccgtgagcttaactcagttggtagggatattgcatattatatgca |
13578490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 259
Target Start/End: Complemental strand, 29771367 - 29771315
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
29771367 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggggccggg |
29771315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 203 - 259
Target Start/End: Complemental strand, 33933811 - 33933755
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||| | |||||| |
|
|
| T |
33933811 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcaggggccggg |
33933755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 246
Target Start/End: Original strand, 48798276 - 48798320
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
48798276 |
atccccgtgagcttagctcagttggtagggatattgcattttata |
48798320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 50512357 - 50512405
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50512357 |
atccccatgagcttagctcagttggtaggaatattgcatattatatgca |
50512405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 255
Target Start/End: Complemental strand, 627049 - 627002
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
627049 |
gtgagtttagctcagttggtagggatattgcatattatatgcaagagc |
627002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 199 - 250
Target Start/End: Complemental strand, 35207227 - 35207176
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
35207227 |
tgtatctccgtgagcttaactcagttgatagggatattgcatattatatgca |
35207176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 12582098 - 12582044
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||| | || ||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
12582098 |
cccgtgagctaatcttagttggtagggatattgcatattatatgcaggagccggg |
12582044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 18360489 - 18360547
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||| ||||||||| | |||||| |
|
|
| T |
18360489 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggg |
18360547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 36602440 - 36602382
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||| ||||||||| | |||||| |
|
|
| T |
36602440 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggg |
36602382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 48615542 - 48615488
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
48615542 |
cccgtgagcataactcagttggtagggatattgcatattatatgcagaagccggg |
48615488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 258
Target Start/End: Original strand, 49056774 - 49056828
Alignment:
| Q |
205 |
cccgtgagctta-gctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
49056774 |
cccgtgagcttaagctcagttggtagggacattgcatattatatgcaggagccgg |
49056828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 53376753 - 53376695
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
53376753 |
tatccccgcgagcttagctcaattggtagggatattgcatgttatatgcaagggccggg |
53376695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 922321 - 922276
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
922321 |
atccccgtaagtttagctcagttggtagaggtattgcatattatat |
922276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 4105727 - 4105772
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
4105727 |
cccgtgagcttagctcagttgatagggatattgcattttatatgca |
4105772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 12167690 - 12167641
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| |||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
12167690 |
tatccctgtgaacttaactcagttggtagggatattgcatattatatgca |
12167641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 15208519 - 15208564
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
15208519 |
atccccgtgagcttaactcagtgggtagggatattgcatattatat |
15208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 15604110 - 15604065
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| ||||||||| |
|
|
| T |
15604110 |
cccgtgagcttagctcagttggtagggatgttgcattttatatgca |
15604065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 256
Target Start/End: Original strand, 20203428 - 20203477
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagcc |
256 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||||||||||| ||||| |
|
|
| T |
20203428 |
cgtgagcttagctcatttggtagagatattgcatattatatgcaggagcc |
20203477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 25726378 - 25726337
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25726378 |
ccgtgggcttagctcagttggtagggatattgcatattatat |
25726337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 36132226 - 36132283
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| |||||||| |||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
36132226 |
atccccgtgagtttagctcaattggtaggaatattgcatattatatgcaggagtcggg |
36132283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 42395225 - 42395270
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
42395225 |
tccctgtgagcttagcttagttggtagggatattgcatattatatg |
42395270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 43481112 - 43481055
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||| ||||||||| | |||||| |
|
|
| T |
43481112 |
atccccgtgagcttaactcagttggtagggatattgcactttatatgcaggggccggg |
43481055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 44312854 - 44312809
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
44312854 |
cccgcgagcttagctcagttggtagggatattgcattttatatgca |
44312809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 56088027 - 56087970
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
56088027 |
atccccataagcttagctcagttggtagggatattgcattttatatgcaggggccggg |
56087970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 542883 - 542839
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
542883 |
ccgtgagcttagctcagttgatagggatattgcatattgtatgca |
542839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 205 - 245
Target Start/End: Complemental strand, 24997504 - 24997464
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
24997504 |
cccgtgagcttagctcagttggtagggatattgcattttat |
24997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 43271786 - 43271742
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
43271786 |
ccgtgagcttagttcagttgatagggatattgcatattatatgca |
43271742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 50442814 - 50442766
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
50442814 |
atccctgtgagcttagctcagttggtagggataatgcataatatatgca |
50442766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 250
Target Start/End: Original strand, 54534835 - 54534871
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54534835 |
ttagctcagttggtagggatattgcatattatatgca |
54534871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 8848279 - 8848240
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
8848279 |
gtgagcttagttcagttggtagggatattgcatattatat |
8848240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 15064270 - 15064227
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15064270 |
cgtgagtttagctcagttggtaggaatattgcatattatatgca |
15064227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 18424967 - 18424924
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
18424967 |
cccgtgaacttaactcagttggtagggatattgcatattatatg |
18424924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 252
Target Start/End: Original strand, 21116777 - 21116828
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatg |
252 |
Q |
| |
|
|||||||||||||||| |||||||| || | |||||||||||||||||||| |
|
|
| T |
21116777 |
tatccccgtgagcttaactcagttgttaagaatattgcatattatatgcatg |
21116828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 27103175 - 27103128
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||| |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
27103175 |
tatctccgtgtgcttagcttagttggtagggatattgcatattatatg |
27103128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 29329897 - 29329850
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
29329897 |
tatccccgtgagcttagctcagttggtaggaatattgtattttatatg |
29329850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 250
Target Start/End: Original strand, 30057232 - 30057267
Alignment:
| Q |
215 |
tagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30057232 |
tagctcagttggtagggatattgcatattatatgca |
30057267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 42381183 - 42381140
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
42381183 |
cccgtgaacttagctcagttggtagggatattgcatgttatatg |
42381140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 259
Target Start/End: Complemental strand, 46998435 - 46998384
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||| | ||||| |||||||||||| |||||||| |
|
|
| T |
46998435 |
gtgagcttagctcagttggtatgaatattgtatattatatgcaggagccggg |
46998384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 52483250 - 52483204
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
52483250 |
tatccccgtgagcttagctcagttggta-ggatgttgcatattatatg |
52483204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 55055914 - 55055961
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
55055914 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatgca |
55055961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 56360786 - 56360739
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| ||||||||| |
|
|
| T |
56360786 |
tatccccgtgaatttagctcagttggtagggatattgcgtattatatg |
56360739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 56479294 - 56479251
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
56479294 |
cgtgaacttaactcagttggtagggatattgcatattatatgca |
56479251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 4357879 - 4357925
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||| | ||||| |||||||||| |
|
|
| T |
4357879 |
atccccgtgaacttagctcagttggtagagatattgtatattatatg |
4357925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 17815492 - 17815450
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
17815492 |
gtgagcttagttcagttggtagggatattacatattatatgca |
17815450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 21380256 - 21380198
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||| |||||||||||||| ||| ||| |||| |
|
|
| T |
21380256 |
tatccccgtgagtttagctcaattgctagggatattgcatattataagcaggaggcggg |
21380198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 25175197 - 25175155
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
25175197 |
gtgagcttagttcagttggtagggatattacatattatatgca |
25175155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 32339319 - 32339369
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| || ||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
32339319 |
gtatcctcgcgagcttaactcagttgttagggatattgcatattatatgca |
32339369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 33530790 - 33530836
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
33530790 |
atcctcgtgagcttagcttaattggtagggatattgcatattatatg |
33530836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 38228438 - 38228480
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
38228438 |
ccgtgagcttagatcagttggtagggatattgcatgttatatg |
38228480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 231
Target Start/End: Original strand, 48949649 - 48949679
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48949649 |
tatccccgtgagcttagctcagttggtaggg |
48949679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 55531250 - 55531308
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| ||| |||| ||||||||| | |||||| |
|
|
| T |
55531250 |
tatccccgtaagcttagctcagttggtggggatatcgcattttatatgcaggggccggg |
55531308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 1439618 - 1439663
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
1439618 |
cccgtgaacttagctcagttggtatggacattgcatattatatgca |
1439663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 4701004 - 4700963
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
4701004 |
tgagtttagctcagttggtagggatattgtatattatatgca |
4700963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 7657059 - 7657108
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||| || | ||| |||||||||||| |
|
|
| T |
7657059 |
tatccccgtgagcttatctcagttggtaaggatgttgtatattatatgca |
7657108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 12720709 - 12720660
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||| |||| ||| |||||||||||||||||| ||||||||| |
|
|
| T |
12720709 |
tatctccgtgagtttagttcaattggtaggggtattgcattttatatgca |
12720660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 12763753 - 12763798
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||| | ||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
12763753 |
atccccgtaaacttagctcagttgctagggatattgcatattatat |
12763798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 17872084 - 17872129
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||||||||| ||||| |
|
|
| T |
17872084 |
atccccgtgagcttagcttaattggtagggatattgcatagtatat |
17872129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 27362903 - 27362854
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||| |||||||||||| | |||| ||||||||||||| |
|
|
| T |
27362903 |
tatctccgtgagcttaactcagttggtagcgatattacatattatatgca |
27362854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 37700672 - 37700627
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||| ||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
37700672 |
atccccgtgagtttacctcggttggtagggatattgcatattatat |
37700627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 42134523 - 42134482
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
42134523 |
tgagcttaactcagttagtagggatattgcatattatatgca |
42134482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 258
Target Start/End: Original strand, 45741471 - 45741528
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
|||||||||||| ||| |||| |||||||| |||||||| ||||||||| ||||||| |
|
|
| T |
45741471 |
tatccccgtgagtttaactcaattggtaggaatattgcatgttatatgcaggagccgg |
45741528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 47890691 - 47890740
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| | | |||||||||||| | |||||||||||||||||| |
|
|
| T |
47890691 |
tatccccgtgagttaaactcagttggtagagatattgcatattatatgca |
47890740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 48744204 - 48744253
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
48744204 |
tatccccatgagcttagctcagttggtagggatataatatattatatgca |
48744253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 48825891 - 48825834
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||| | || ||||||||| |||||||| |
|
|
| T |
48825891 |
atccccgtgagcttaactcaattggtagggatatcgaattttatatgcaggagccggg |
48825834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 53634324 - 53634279
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||| ||||||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
53634324 |
atccccatgagcttagttcagttcgtagggatattgcatattatat |
53634279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 2688097 - 2688146
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
2688097 |
atccccgtgagcttagct----tggtagggatattgcatattatatgcaggagc |
2688146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 2771037 - 2771081
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| || || || |||||||||||||||||| |
|
|
| T |
2771037 |
ccgtgagcttagctcagctgatatggatattgcatattatatgca |
2771081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Original strand, 3161019 - 3161047
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3161019 |
tccccgtgagcttagctcagttggtaggg |
3161047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 3784913 - 3784957
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||| | |||||| |
|
|
| T |
3784913 |
ccgtgagcttagctcaattggtagggatattgcataatttatgca |
3784957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 10407101 - 10407062
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
10407101 |
gtgagcttagctcagttggta-ggatattgcatattatatg |
10407062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 21432616 - 21432656
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
21432616 |
cgtgagcttagttcagttggtagagatattgcatattatat |
21432656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 46
Target Start/End: Complemental strand, 38220448 - 38220416
Alignment:
| Q |
14 |
agttcacaaaatatacaaattttgattgttttt |
46 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
38220448 |
agttcacaaaatatacaaattttgatttttttt |
38220416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 54103637 - 54103589
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| | ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
54103637 |
atccccgtgcgtttaactcagttgatagggatattgcatattatatgca |
54103589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 250
Target Start/End: Original strand, 55021563 - 55021599
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55021563 |
ttagctcagttggtaggaatattgcatattatatgca |
55021599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 94 - 36
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
94 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
36 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 59779 - 59837
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
59779 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
59837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 266771 - 266713
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
266771 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
266713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 156)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 17698518 - 17698576
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
17698518 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
17698576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 201 - 258
Target Start/End: Complemental strand, 94585 - 94528
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
94585 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgg |
94528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 198 - 259
Target Start/End: Original strand, 1937303 - 1937364
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
1937303 |
ttgtatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggg |
1937364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 10736947 - 10736890
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
10736947 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
10736890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 29716857 - 29716914
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
29716914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 34413059 - 34413116
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
34413059 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
34413116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 259
Target Start/End: Original strand, 6659284 - 6659343
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
6659284 |
gtatccccgtgagattagctcagttggtagggatattgcatattatatgcaggagccggg |
6659343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 259
Target Start/End: Original strand, 6739686 - 6739745
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
6739686 |
gtatccccgtgagattagctcagttggtagggatattgcatattatatgcaggagccggg |
6739745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 201 - 260
Target Start/End: Complemental strand, 30972891 - 30972832
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
30972891 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgccggagccgggt |
30972832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 17027954 - 17027896
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
17027954 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgccggagccggg |
17027896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 17558390 - 17558332
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
17558390 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgccggagccggg |
17558332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 12299 - 12250
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12299 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
12250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 206 - 259
Target Start/End: Complemental strand, 2787150 - 2787097
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
2787097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 6280477 - 6280534
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||| |
|
|
| T |
6280477 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgcaggagccggg |
6280534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 8265264 - 8265313
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8265264 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
8265313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 11875883 - 11875936
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
11875883 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
11875936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 11890890 - 11890943
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
11890890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
11890943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 14876675 - 14876618
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtagggaaattgcatattatatgcaggagccggg |
14876618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 26022244 - 26022301
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
26022244 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
26022301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 28909462 - 28909519
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
28909462 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggg |
28909519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 35939484 - 35939541
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
35939484 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
35939541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 37717360 - 37717417
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
37717360 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggg |
37717417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 39362261 - 39362310
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39362261 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
39362310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 41689878 - 41689927
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41689878 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
41689927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 43284039 - 43283982
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
43284039 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggg |
43283982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 16449122 - 16449170
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16449122 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
16449170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 203 - 259
Target Start/End: Complemental strand, 23178963 - 23178907
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
23178907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 32719680 - 32719632
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
32719632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 199 - 250
Target Start/End: Original strand, 34266006 - 34266057
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34266006 |
tgtatccccgcgagcttagctcagttggtagggatattgcatattatatgca |
34266057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 43656032 - 43656079
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43656032 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
43656079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 8034486 - 8034428
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
8034486 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggggccggg |
8034428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 10200755 - 10200697
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| ||||||||||||||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
10200755 |
tatcctcgtgagcttagctcagttggtagagatattgcatattatatgcaggagccggg |
10200697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 16432202 - 16432144
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| |||||| ||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
16432202 |
tatctccgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggg |
16432144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 26567322 - 26567264
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||| ||| |||| |
|
|
| T |
26567322 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggagtcggg |
26567264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 255
Target Start/End: Original strand, 29514622 - 29514676
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
29514622 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggagc |
29514676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 34158727 - 34158673
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
34158727 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggg |
34158673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 199 - 252
Target Start/End: Complemental strand, 38745355 - 38745301
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcata-ttatatgcatg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
38745355 |
tgtatccccgtgagcttagctcagttggtagggatattgcatatttatatgcatg |
38745301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 133412 - 133469
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||| ||| |||| |
|
|
| T |
133412 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcaggagtcggg |
133469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 2792776 - 2792833
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||| | |||||| |
|
|
| T |
2792776 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggg |
2792833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 7797127 - 7797184
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||| |||||||||||| |||||||| |
|
|
| T |
7797127 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgcaggagccggg |
7797184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 7816400 - 7816457
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||| |||||||||||| |||||||| |
|
|
| T |
7816400 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgcaggagccggg |
7816457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 258
Target Start/End: Original strand, 13406596 - 13406653
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
13406596 |
tatctccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgg |
13406653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 23435306 - 23435249
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||||||||||||||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
23435306 |
atccctgtgagcttagctcagttgatagggatattgcatattatatgcaggagccggg |
23435249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 206 - 259
Target Start/End: Complemental strand, 31451026 - 31450973
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
31451026 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggg |
31450973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 34894366 - 34894423
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
34894366 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
34894423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 38219641 - 38219584
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
38219641 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagtcggg |
38219584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 38620414 - 38620357
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||| |
|
|
| T |
38620414 |
atccctgtgagcttagctcagttggtagggatattgtatattatatgcaggagccggg |
38620357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 208 - 257
Target Start/End: Original strand, 42006781 - 42006830
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
42006781 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccg |
42006830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 42880945 - 42881002
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| | |||||||| |
|
|
| T |
42880945 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgtaggagccggg |
42881002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 20540179 - 20540131
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
20540179 |
atccccgtgagcttagctcagttgttagggatattgcatattatatgca |
20540131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 23858198 - 23858242
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23858198 |
ccgtgagcttagctcagttggtagggatattgcatattatatgca |
23858242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 33617969 - 33618017
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
33617969 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
33618017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 44340418 - 44340374
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44340418 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
44340374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 209 - 259
Target Start/End: Original strand, 7194266 - 7194316
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatgcaggagccggg |
7194316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 7388450 - 7388500
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
7388450 |
gtatccccgtgaacttaactcagttggtagggatattgcatattatatgca |
7388500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 7765643 - 7765697
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||| || |||| ||||||||||||| |||||||| |
|
|
| T |
7765643 |
cccgtgagcttagctcagttggtatggatattacatattatatgcaggagccggg |
7765697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 209 - 259
Target Start/End: Complemental strand, 22274677 - 22274627
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
22274677 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggg |
22274627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 24458313 - 24458371
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| |||||||||||| | |||||| |
|
|
| T |
24458313 |
tatccccgtgagcttagctcagttggaagggatattgtatattatatgcaggggccggg |
24458371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 27077164 - 27077122
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27077164 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
27077122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 28420498 - 28420440
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
28420498 |
tatcctcgtgagcttagctcagttggtaggaatattgcatattatatgctggagccggg |
28420440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 256
Target Start/End: Original strand, 43186850 - 43186904
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagcc |
256 |
Q |
| |
|
|||| |||||| |||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
43186850 |
atccgcgtgagtttagctcagttggtagggatattgcatattatatgcaggagcc |
43186904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 257535 - 257584
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
257535 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgca |
257584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 658385 - 658336
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
658385 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgca |
658336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 844121 - 844072
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
844121 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgca |
844072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 5328640 - 5328583
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| || ||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
5328640 |
atccctgtaagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
5328583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 8698648 - 8698607
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8698648 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
8698607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 10568081 - 10568130
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
10568081 |
tatccccgtgagtttagctcagttggtagggatattgcatattaaatgca |
10568130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 10587347 - 10587302
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10587347 |
cccgtaagcttagctcagttggtagggatattgcatattatatgca |
10587302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 17072636 - 17072579
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
17072636 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggg |
17072579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 17575635 - 17575692
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
17575635 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggg |
17575692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 26280857 - 26280800
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
26280857 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgccggagccggg |
26280800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 34472297 - 34472342
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
34472297 |
cccgtgagcttaactcagttggtagggatattgcatattatatgca |
34472342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 38955267 - 38955210
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||| ||||||||||||| | |||||| |
|
|
| T |
38955267 |
atccccgtgagcttaactcagttggtagggatattacatattatatgcaggggccggg |
38955210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 40362048 - 40362093
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
40362048 |
cccgtgagcttagctcagttagtagggatattgcatattatatgca |
40362093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 3190022 - 3189974
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3190022 |
atccccgtgtgcatagctcagttggtagggatattgcatattatatgca |
3189974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 5326243 - 5326195
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
5326243 |
atccccgtgagcttagctcagttggtagagatattgcattttatatgca |
5326195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 10083164 - 10083208
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
10083164 |
ccgtgagcttaactcagttggtagggatattgcatattatatgca |
10083208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 24296937 - 24296893
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
24296937 |
ccgtgagcttagctcagttagtagggatattgcatattatatgca |
24296893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 28628662 - 28628710
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| || |||| ||||||||||||| |
|
|
| T |
28628662 |
atccccgtgagcttagctcagttggtacggatattacatattatatgca |
28628710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 36540284 - 36540332
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
36540284 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgca |
36540332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 255
Target Start/End: Original strand, 38344051 - 38344099
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
38344051 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
38344099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 2079746 - 2079699
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
2079746 |
tatccccgtgagcttagctcagttggtagtggtattacattttatatg |
2079699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 255
Target Start/End: Complemental strand, 4615747 - 4615696
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
4615747 |
ccccgtgagtttagttcagttggtagggatattgcatattatatgcaggagc |
4615696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 9187296 - 9187249
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||| |||||||| |
|
|
| T |
9187296 |
atccccgtgagcttagctcagttggtagggatattacattttatatgc |
9187249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 250
Target Start/End: Original strand, 10573103 - 10573146
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10573103 |
cgtgagtttagctcagttggtagggatattgcatattatatgca |
10573146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 259
Target Start/End: Complemental strand, 10594287 - 10594232
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||| | ||||||||||| |||||||| ||||||||| |||||||| |
|
|
| T |
10594287 |
ccccgtgagcttagtttagttggtagggatattgcattttatatgcaggagccggg |
10594232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 26192784 - 26192741
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
26192784 |
cgtgagcttagttcagttggtagggatattgcatattatatgca |
26192741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 29729113 - 29729160
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
29729113 |
gtatccccgtgagtttagttcagttggtagggatattgcatattatat |
29729160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 37092088 - 37092135
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
37092088 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgc |
37092135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 38402249 - 38402296
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
38402249 |
tccccgtgagcttaactcagttggtagggatattgcatattatttgca |
38402296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 250
Target Start/End: Original strand, 41458297 - 41458340
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
41458297 |
cgtgagcttaactcagttggtagggatattgcatattatatgca |
41458340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 259
Target Start/End: Complemental strand, 43856453 - 43856398
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
43856453 |
ccccgtgagcttaactcagttggtagggatattgcattttatatgcaggggccggg |
43856398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 1503906 - 1503963
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| |||||||||||||||||| |||| ||||| |||||||||||| |||||||| |
|
|
| T |
1503906 |
tatccccatgagcttagctcagttggcagggatattg-atattatatgcaggagccggg |
1503963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 2168521 - 2168475
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
2168521 |
tatccccgtgagcttagctcagttggtagggatattacattttatat |
2168475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 2590146 - 2590192
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
2590146 |
atccccgtgagcttagctcaattagtagggatattgcatattatatg |
2590192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 8862193 - 8862151
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8862193 |
gtgagcttagctaagttggtagggatattgcatattatatgca |
8862151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 8953943 - 8953885
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||||||||| | |||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
8953943 |
tatcctcgtgagcttaacacagttggtagggatattgcatattatatgcaggagtcggg |
8953885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 11297063 - 11297009
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| ||||||| ||||| |||| |
|
|
| T |
11297063 |
cccgtgagcttagttcagttggtagggatattgcattttatatgtatgagtcggg |
11297009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 29260615 - 29260673
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||||||||| ||||| |||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
29260615 |
tatccacgtgagcttaactcagctggtagggatattgcatattatatgcaggagtcggg |
29260673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 43053959 - 43053901
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||| ||||||||||||| ||| |||| |
|
|
| T |
43053959 |
tatctccgtgagcttaactcagttggtagggatatttcatattatatgcaggagtcggg |
43053901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 4654176 - 4654135
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
4654176 |
tgagcttagctcagttgctagggatattgcatattatatgca |
4654135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 5570894 - 5570939
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||| ||||||||| |
|
|
| T |
5570894 |
cccgtgagcttagctcagttggttgggatattgcatgttatatgca |
5570939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 210 - 259
Target Start/End: Complemental strand, 7764004 - 7763955
Alignment:
| Q |
210 |
gagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||| | |||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatgcaggggccggg |
7763955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 10030409 - 10030466
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| ||||| |||||||||||||||| | |||||||||||||||||| | |||||| |
|
|
| T |
10030409 |
atccctgtgagtttagctcagttggtagagatattgcatattatatgcaggtgccggg |
10030466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 33604246 - 33604198
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
33604246 |
tatccccgtgagcttagctcagttggtagggatattg-atattacatgca |
33604198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 37090686 - 37090629
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||||| |||||||||||| ||| |||| |
|
|
| T |
37090686 |
atccccgtgagtttaactcagttggtagggatattgtatattatatgcaggagtcggg |
37090629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 39587544 - 39587589
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
39587544 |
atccccgtgagcttagctcagttggtagagatattgcattttatat |
39587589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 41616439 - 41616382
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| || |||||||||||||| ||||| |||||||||||| | |||||| |
|
|
| T |
41616439 |
atccccgtgagcataactcagttggtagggatattgtatattatatgcaggggccggg |
41616382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 197131 - 197091
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
197131 |
gtgagcttagctcagttggtagggatattgcatataatatg |
197091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 311968 - 311928
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
311968 |
gtgagcttagctcagttggtagggatattgcatataatatg |
311928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 205 - 257
Target Start/End: Complemental strand, 18452355 - 18452303
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||| || |||||| |
|
|
| T |
18452355 |
cccgtgagcttagctcagttgttaggaatattgcatattatatacaggagccg |
18452303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 18942918 - 18942962
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatg |
252 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| |||||||||| |
|
|
| T |
18942918 |
gtgagcttagctcagttggtagggataatgcataatatatgcatg |
18942962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 22487876 - 22487920
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
22487876 |
ccgtgagtttagctcagttggtagggatattgcattttatatgca |
22487920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 26734069 - 26734117
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26734069 |
atccccgtaagcttagctcagttggtagatatattgcatattatatgca |
26734117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 28460203 - 28460243
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
28460203 |
cgtgagcttaactcagttggtagggatattgcatattatat |
28460243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 32258007 - 32258051
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32258007 |
cccgtgagattagctcagttggtagggatattgcatattctatgc |
32258051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 210 - 250
Target Start/End: Complemental strand, 37524272 - 37524232
Alignment:
| Q |
210 |
gagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatattatatgca |
37524232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 43980382 - 43980338
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
43980382 |
ccgtgagcttagttcagttgttagggatattgcatattatatgca |
43980338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 481009 - 481056
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| | |||||| |
|
|
| T |
481009 |
tccccgtgagcttagctcagttggtagggacattgcataatttatgca |
481056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 259
Target Start/End: Complemental strand, 1632507 - 1632456
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||| ||| |||| |
|
|
| T |
1632507 |
gtgagcttagctcagttggtaggaatattacatattatatgcaggagtcggg |
1632456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 3949148 - 3949109
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3949148 |
gtgagcttaactcagttggtagggatattgcatattatat |
3949109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 255
Target Start/End: Original strand, 8969098 - 8969145
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
8969098 |
gtgagcttagctaagttggtaggaatattgcatattatatgcaggagc |
8969145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 260
Target Start/End: Original strand, 11483120 - 11483175
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
||||||||| |||||||||| ||||| |||||||||||||||||| |||| |||| |
|
|
| T |
11483120 |
cccgtgagcgtagctcagttagtaggaatattgcatattatatgcaggagcggggt |
11483175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 14245142 - 14245189
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||| | ||||||||||| |||||||||||||||| |
|
|
| T |
14245142 |
tatccccgtgagtttaggtaagttggtagggatattgcatattatatg |
14245189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 22437858 - 22437815
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
22437858 |
cgtgagcttagctcagttggtagggatattgcataatttatgca |
22437815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 33838324 - 33838367
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| |||||||| |
|
|
| T |
33838324 |
cccgtgagtttagctcagttggtagggatattgcaaattatatg |
33838367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 3227073 - 3227024
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
3227073 |
gtatccccgtgagattagttcagttggta-ggatattgcatattatatgca |
3227024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 212 - 250
Target Start/End: Complemental strand, 7109353 - 7109315
Alignment:
| Q |
212 |
gcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7109353 |
gcttagctcagttggtagagatattgcatattatatgca |
7109315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 7453349 - 7453395
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||| |||||||| |||||||| ||||||| |
|
|
| T |
7453349 |
atccccgtgagtttagctcagctggtagggatattgcattttatatg |
7453395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Complemental strand, 12273747 - 12273705
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
12273747 |
cccgtgagcttagctcagttagtaggaatattgcatattatat |
12273705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 37535566 - 37535524
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
37535566 |
gtgagtttagctcaattggtagggatattgcatattatatgca |
37535524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 2294173 - 2294124
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||| |||| ||||||||||||| |
|
|
| T |
2294173 |
tatccccgtgagtttagctcaattgatagggatattacatattatatgca |
2294124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 8402406 - 8402361
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
8402406 |
cccgtgagcttagctcaattggtagggacattgcataatatatgca |
8402361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 9370162 - 9370213
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttg---gtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
9370162 |
atccccatgagcttagctcagttgttggtagggatattgcatattatatgca |
9370213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 260
Target Start/End: Original strand, 11127905 - 11127958
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| || || |||||| |
|
|
| T |
11127905 |
cgtgaacttagctcagttggtaggaatattgcatattatatacaggatccgggt |
11127958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 13773465 - 13773408
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||| | ||||||||||||||| | |||||||||||||||| | |||||||| |
|
|
| T |
13773465 |
atcccagtgaacgtagctcagttggtagagatattgcatattatatgtaggagccggg |
13773408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 18926209 - 18926160
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| ||| |||| ||||||||| |
|
|
| T |
18926209 |
tatccccgtgaccttagctcaattggtagggatatcgcattttatatgca |
18926160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 229
Target Start/End: Complemental strand, 21548580 - 21548551
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21548580 |
gtatccccgtgagcttagctcagttggtag |
21548551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 29734078 - 29734021
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| ||| ||||||||||| || ||||| |||||||||||| ||| |||| |
|
|
| T |
29734078 |
atccccgtgagtttaactcagttggtaaggatattgtatattatatgcaggagtcggg |
29734021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 37290922 - 37290967
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| || ||||| ||||| |||||||||||||||||| |
|
|
| T |
37290922 |
cccgtgagcttaacttagttgatagggatattgcatattatatgca |
37290967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 40094885 - 40094930
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||| || || |||||||| ||||||||| |
|
|
| T |
40094885 |
cccgtgagcttagctcagttgataaggatattgcattttatatgca |
40094930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 40740525 - 40740570
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
40740525 |
cccgtaagcttaactcagttgatagggatattgcatattatatgca |
40740570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 246
Target Start/End: Original strand, 42457133 - 42457174
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
42457133 |
cccgtgagtttatctcagttggtagggatattgcatattata |
42457174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 43085296 - 43085239
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| ||| ||||||||| | |||||| |
|
|
| T |
43085296 |
atccccgtgagcttagctcagttgggagggatatcacattttatatgcaggggccggg |
43085239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 44673718 - 44673673
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
44673718 |
cccgtgagcttagctcagttggtagggatatcacattttatatgca |
44673673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 250
Target Start/End: Complemental strand, 1286617 - 1286577
Alignment:
| Q |
210 |
gagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
1286617 |
gagcttatctcaattggtagggatattgcatattatatgca |
1286577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 3912237 - 3912189
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
3912237 |
atccccgtgagtttaactcggttggtaggaatattgcatattatatgca |
3912189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Complemental strand, 13059249 - 13059221
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13059249 |
tccccgtgagcttagctcagttggtaggg |
13059221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 13591816 - 13591864
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||| |||| ||||||||| |
|
|
| T |
13591816 |
atccccgtgagtttaactcagttggtagggatatcgcattttatatgca |
13591864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 13647518 - 13647482
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| |
|
|
| T |
13647518 |
ttagctcagttggtagagatattgcatattatatgca |
13647482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 13747943 - 13747907
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||| |
|
|
| T |
13747943 |
ttagctcagttggtagagatattgcatattatatgca |
13747907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 19161964 - 19161921
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
19161964 |
ccgtaagcttagctcagttggta-ggatattgcatattatatgca |
19161921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 37838578 - 37838622
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
37838578 |
ccgtaagcttagctcaaatggtagggatattgcatattatatgca |
37838622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 39974841 - 39974877
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39974841 |
cccgtgagcttagctcagttggtaggaatattgcata |
39974877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 42877410 - 42877362
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| || ||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
42877410 |
atccccgcgaacttagctcagttggtagagatattgtatattatatgca |
42877362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 250
Target Start/End: Original strand, 44444557 - 44444589
Alignment:
| Q |
218 |
ctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
44444557 |
ctcagttggtagggatattgcatattatatgca |
44444589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 118)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 29617401 - 29617459
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
29617401 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
29617459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 44616598 - 44616656
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
44616598 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
44616656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 12640662 - 12640605
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
12640662 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
12640605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 42443686 - 42443743
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
42443686 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
42443743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 259
Target Start/End: Complemental strand, 19753043 - 19752984
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
19753043 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
19752984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 2681092 - 2681150
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
2681092 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
2681150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 9877341 - 9877283
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
9877341 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
9877283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 10244963 - 10244905
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||| |
|
|
| T |
10244963 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggagccggg |
10244905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 15238885 - 15238943
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
15238885 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
15238943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 24061403 - 24061345
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
24061403 |
tatccccgtgagcttagctcagttggtaggaatattgcatattatatgcaggagccggg |
24061345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 24781030 - 24781084
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
24781030 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
24781084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 27510327 - 27510273
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
27510327 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
27510273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 35950124 - 35950182
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
35950124 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
35950182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 2228972 - 2229029
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
2228972 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
2229029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 3766808 - 3766865
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
3766808 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggg |
3766865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 23102631 - 23102574
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
23102574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 31026216 - 31026273
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
31026216 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggg |
31026273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 206 - 259
Target Start/End: Original strand, 36174391 - 36174444
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
36174444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 25833552 - 25833600
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25833552 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
25833600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 47641041 - 47641088
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47641041 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
47641088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 209 - 259
Target Start/End: Complemental strand, 32677008 - 32676958
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
32676958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 36391974 - 36391920
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
36391920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 36469779 - 36469721
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||| ||||| |||||||| |
|
|
| T |
36469779 |
tatccccgtgagcttagctcagttggtagggatattacatattacatgcaggagccggg |
36469721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 37300172 - 37300126
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37300172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
37300126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 256
Target Start/End: Complemental strand, 46534821 - 46534767
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagcc |
256 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
46534821 |
atccccatgagcttagctcagttggtagggatattgcatattatatgcaggagcc |
46534767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 47999777 - 47999823
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47999777 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
47999823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 5990219 - 5990170
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
5990219 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgca |
5990170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 12772112 - 12772169
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
12772112 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
12772169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 21388520 - 21388577
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
21388520 |
atccccatgagcgtagctcagttggtagggatattgcatattatatgcaggagccggg |
21388577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 27424836 - 27424893
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||| | |||||| |
|
|
| T |
27424836 |
atccccgtgagcttagctcagttggaagggatattgcatattatatgcaggggccggg |
27424893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 30940767 - 30940816
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
30940767 |
tatccccgtgagcttagctcagttggtagtgatattgcatattatatgca |
30940816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 36622171 - 36622228
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
36622171 |
atccccgtgaacttagctcaattggtagggatattgcatattatatgcatgggccggg |
36622228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 207 - 259
Target Start/End: Complemental strand, 30388575 - 30388523
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
30388575 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
30388523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 30806112 - 30806160
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30806112 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgca |
30806160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 38889566 - 38889518
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
38889566 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
38889518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 199 - 259
Target Start/End: Original strand, 39098130 - 39098190
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
39098130 |
tgtatccctgtgagcttagttcagttggtagggatattgcatattatatgcaagggccggg |
39098190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 41084040 - 41084084
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41084040 |
ccgtgagcttagctcagttggtagggatattgcatattatatgca |
41084084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 42182267 - 42182223
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42182267 |
ccgtgagcttaactcagttggtaggggtattgcatattatatgca |
42182223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 48288470 - 48288419
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
48288470 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccg |
48288419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 15106765 - 15106707
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| ||||||||| |||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
15106765 |
tatcccggtgagcttaactcagttggtagggatattgcatattatatgcaggagtcggg |
15106707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 21066883 - 21066929
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
21066883 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
21066929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 24692470 - 24692520
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
24692470 |
gtatccccgtgaggttagctcagttggtagggatattgcatattctatgca |
24692520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 24880526 - 24880468
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| |||| ||||||||||||||||||||| ||||| |||||||||||| |||||||| |
|
|
| T |
24880526 |
tatctccgtaagcttagctcagttggtagggatattgaatattatatgcaggagccggg |
24880468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 26801803 - 26801745
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
26801803 |
tatccccgtgagtatagctcagttggtaggaatattgcatattatatgcaggagccggg |
26801745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 29625917 - 29625974
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
29625917 |
tatccacgtgagcttaactcagttggtagggatattgcatattatatgca-gagccggg |
29625974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 255
Target Start/End: Complemental strand, 34267621 - 34267571
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
34267621 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgcaggagc |
34267571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 35645595 - 35645653
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||| |||||||||||| |||||||| |
|
|
| T |
35645595 |
tatccccatgagcgtagctcagttggtagggatattgtatattatatgcaggagccggg |
35645653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 48119465 - 48119515
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
48119465 |
gtatccctgtgagcttagctcagttggtagggatattgcattttatatgca |
48119515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 9929978 - 9929929
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
9929978 |
tatccccgttagcttagctcagttggtagggatattgaatattatatgca |
9929929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 33996954 - 33996897
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
33996954 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgcaggagtcggg |
33996897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 35815834 - 35815883
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
35815834 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgca |
35815883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 36389740 - 36389691
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
36389740 |
tatccccgtgagcttagctcagttggtagggatattgtattttatatgca |
36389691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 41465834 - 41465879
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41465834 |
cccgtaagcttagctcagttggtagggatattgcatattatatgca |
41465879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 9712267 - 9712223
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
9712267 |
ccgtgagcttaactcagttggtagggatattgcatattatatgca |
9712223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 36720109 - 36720149
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36720109 |
cgtgagcttagctcagttggtagggatattgcatattatat |
36720149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 5833037 - 5833084
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
5833037 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
5833084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 18223787 - 18223744
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
18223787 |
cccgtgagcttaactcagttggtagggatattgcatattatatg |
18223744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 24062081 - 24062038
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
24062081 |
cccgtgagcttagctcagttagtagggatattgcatattatatg |
24062038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 250
Target Start/End: Complemental strand, 26816730 - 26816683
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
26816730 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
26816683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 32984284 - 32984245
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32984284 |
gtgagcttagctcagttggtagggatattgcatattatat |
32984245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 209 - 259
Target Start/End: Original strand, 4960788 - 4960838
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||| ||| |||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatgcaggagtcggg |
4960838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 12615746 - 12615796
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
12615746 |
gtatccccttgagcttaactcagttgatagggatattgcatattatatgca |
12615796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 259
Target Start/End: Original strand, 48719807 - 48719853
Alignment:
| Q |
213 |
cttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
48719807 |
cttagctcagttggtaggaatattgcatattatatgcaggagccggg |
48719853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 198 - 247
Target Start/End: Original strand, 3529773 - 3529822
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| |||||||| |||||| |
|
|
| T |
3529773 |
ttgtatccccgtgagtttaactcagttggtagggatattgcattttatat |
3529822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 5073263 - 5073312
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||||||||||| | ||||| |||||||||||| |
|
|
| T |
5073263 |
tatccccgtgagcttaactcagttggtagagatattgtatattatatgca |
5073312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 9233836 - 9233787
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| || ||||||||| |
|
|
| T |
9233836 |
tatccccgtgagcttaactcagttggtagggatattgaattttatatgca |
9233787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 12264050 - 12264099
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||| ||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
12264050 |
tatctccgtgaacttagctcagttggtagggatattgcattttatatgca |
12264099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 13720767 - 13720824
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||| |
|
|
| T |
13720767 |
atccccgtgaagttagctcagttggttgggatattgcatattatatgcaggggccggg |
13720824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 15694546 - 15694595
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
15694546 |
tatccccgtgagcttaattcagttggtagggatattgtatattatatgca |
15694595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 15701526 - 15701575
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
15701526 |
tatccccgtgagcttaattcagttggtagggatattgtatattatatgca |
15701575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 21762966 - 21762917
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
21762966 |
tatccccgtgaacttatctcagttggtaaggatattgcatattatatgca |
21762917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 23755088 - 23755039
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||| |||||| |
|
|
| T |
23755088 |
tatccccgtgagcttagctcaatcggtagggatattgcatattttatgca |
23755039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 27704373 - 27704324
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
27704373 |
tatccccgtgaacttaactcagttggtaggaatattgcatattatatgca |
27704324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 209 - 250
Target Start/End: Original strand, 28805304 - 28805345
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatgca |
28805345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 32074469 - 32074420
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
32074469 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgca |
32074420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 32619347 - 32619404
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||| || || |||||||||||||||| | |||||||| |
|
|
| T |
32619347 |
atccccgtgagcttaactcagttgttaaggatattgcatattatatgtaggagccggg |
32619404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 35683197 - 35683152
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
35683197 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgca |
35683152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 38824699 - 38824650
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
38824699 |
tatctccgtgagcttagctcagttgatagggatattgcgtattatatgca |
38824650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 7525441 - 7525489
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
7525441 |
atccccgtgagtttagttcagttggtaaggatattgcatattatatgca |
7525489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 10226672 - 10226720
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||| ||||||||||||| | |||||||||||||||| |
|
|
| T |
10226672 |
atccccgtgagtttagttcagttggtagggatgttgcatattatatgca |
10226720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 24188471 - 24188515
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||||||||||| |
|
|
| T |
24188471 |
ccgtgagcatagctcagttggtagggatactgcatattatatgca |
24188515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 24732618 - 24732578
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
24732618 |
gtgagcttagctcagttgttagggatattgcatattatatg |
24732578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 27679083 - 27679035
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
27679083 |
atcctcgtgagcttaactcagttggtatggatattgcatattatatgca |
27679035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 36114414 - 36114366
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| |||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
36114414 |
atccccgtaagcttaactcagttaataggggtattgcatattatatgca |
36114366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 10691 - 10648
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10691 |
cgtgatcttagcttagttggtagggatattgcatattatatgca |
10648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 9497962 - 9498009
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
9497962 |
tatccccgcgagtttagctcaattggtagggatattgcatattatatg |
9498009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 259
Target Start/End: Complemental strand, 13730164 - 13730113
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||||||||||| | |||||| |
|
|
| T |
13730164 |
gtgagcttagcttagttggtagagatattgcatattatatgcaggggccggg |
13730113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 24508822 - 24508869
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
24508822 |
tatcccagtgagcgtagttcagttggtagggatattgcatattatatg |
24508869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 197 - 248
Target Start/End: Original strand, 41699631 - 41699682
Alignment:
| Q |
197 |
gttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||| ||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
41699631 |
gttgaatctccgtgagcttagctcagttagtagggatattgcatatcatatg |
41699682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 259
Target Start/End: Complemental strand, 1563797 - 1563755
Alignment:
| Q |
217 |
gctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
1563797 |
gctcagttggtagggatattgcatattatatgcaggggccggg |
1563755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 12364745 - 12364791
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||| ||||||||| |
|
|
| T |
12364745 |
tatccccgtgagcttaactcacttggtagggatattgtatattatat |
12364791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 19922169 - 19922123
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| |||||||| ||||||| |
|
|
| T |
19922169 |
atccccgtgagcttagcttagttgatagggatattgcattttatatg |
19922123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 246
Target Start/End: Original strand, 28735731 - 28735769
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
28735731 |
gtgagcttaactcagttggtagggatattgcatattata |
28735769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 31769582 - 31769528
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| | || ||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
31769582 |
cccgtgagataagttcagttggtagggatattgcatattatatgcaggagtcggg |
31769528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 47255152 - 47255098
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| ||||||||| || | ||||||||||||| |||| |||||||| |
|
|
| T |
47255152 |
cccgtgagcttaactcagttggcagagatattgcatattatctgcaggagccggg |
47255098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 3392465 - 3392510
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||| |||||||| || || |||||||||||||||| |
|
|
| T |
3392465 |
tccccgtgagcttaactcagttgatatggatattgcatattatatg |
3392510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 5804851 - 5804900
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| || ||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
5804851 |
tatccctgtaagcttagcttagttggtagggatattgcattttatatgca |
5804900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Original strand, 15655708 - 15655749
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
15655708 |
tgagcttagctcaattggtagggatattgcattttatatgca |
15655749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 15716751 - 15716710
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
15716751 |
tgagtttagctcagttggtagggatattgcgtattatatgca |
15716710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 211 - 252
Target Start/End: Complemental strand, 28602529 - 28602488
Alignment:
| Q |
211 |
agcttagctcagttggtaggggtattgcatattatatgcatg |
252 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
28602529 |
agcttagctcagttggtaggaatattacatattatatgcatg |
28602488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 31191670 - 31191625
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
31191670 |
cccgtgagcttaattcagttggtaaggatattgcatattatatgca |
31191625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 32856987 - 32856942
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
32856987 |
cccgtgaacttagcttaattggtagggatattgcatattatatgca |
32856942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 35612633 - 35612592
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
35612633 |
tgagcttagctcaattggtagggagattgcatattatatgca |
35612592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 248
Target Start/End: Complemental strand, 40518961 - 40518916
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| |||||| |
|
|
| T |
40518961 |
tccccgtgaacttagctcagttggtagggacattgcataatatatg |
40518916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 210 - 259
Target Start/End: Complemental strand, 43633155 - 43633106
Alignment:
| Q |
210 |
gagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||||||||||| |||||||| |
|
|
| T |
43633155 |
gagcttagctcagttgatagggatattatatattatatgcaggagccggg |
43633106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 47543042 - 47543001
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| | |||||| |
|
|
| T |
47543042 |
tgagcttagctcagttggtaggggcattgcataatttatgca |
47543001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 211 - 259
Target Start/End: Complemental strand, 1398967 - 1398919
Alignment:
| Q |
211 |
agcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| |||||||||| ||| |||||||||||||||||| | |||||| |
|
|
| T |
1398967 |
agcttaactcagttggttgggatattgcatattatatgcaggggccggg |
1398919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 3532575 - 3532623
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
3532575 |
atcctcgtgatcttagttcagttggtagggatattgcataatatatgca |
3532623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 7401456 - 7401412
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
7401456 |
ccgtgagtttaactcagttggtagggatattgtatattatatgca |
7401412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 11692385 - 11692433
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||| |||||||| |||| |||| |||||||| |
|
|
| T |
11692385 |
atccccgtgagtttagctcagatggtagggatattacataatatatgca |
11692433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 16200556 - 16200604
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||||||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
16200556 |
atcccggtgagcttagcttaattggtaggaatattgcatattatatgca |
16200604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 19331570 - 19331522
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
19331570 |
atccccgtgagcttagtgcagttggtacggatattgcattttatatgca |
19331522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 19828127 - 19828171
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
19828127 |
ccgtgaacttagctcagttggtagggatatcgcattttatatgca |
19828171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 250
Target Start/End: Original strand, 27633940 - 27633976
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
27633940 |
ttagcttagttggtagggatattgcatattatatgca |
27633976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 28444155 - 28444107
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||| | ||| |||| ||||||||| |
|
|
| T |
28444155 |
atccccgtgagcttaactcagttggtagagatatcgcattttatatgca |
28444107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 240
Target Start/End: Original strand, 38151347 - 38151379
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
38151347 |
gtgagcttagctcagttggtagggatattgcat |
38151379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 198 - 250
Target Start/End: Original strand, 42352643 - 42352695
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| ||||| || |||||||| |
|
|
| T |
42352643 |
ttgtgtccccgtgagctttgctcagttggtagggacattgcctaatatatgca |
42352695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 42798386 - 42798342
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
|||||||||||| | ||||| |||||| ||||||||||||||||| |
|
|
| T |
42798386 |
cccgtgagcttaacccagtttgtagggatattgcatattatatgc |
42798342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 144)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 37800685 - 37800627
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
37800685 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
37800627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 40933905 - 40933847
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
40933905 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
40933847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 45701340 - 45701398
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
45701340 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
45701398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 50496888 - 50496830
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
50496888 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
50496830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 7920317 - 7920374
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
7920317 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggg |
7920374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 31327574 - 31327517
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
31327574 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
31327517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 31327791 - 31327734
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
31327791 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
31327734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 32144581 - 32144638
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32144581 |
atccccgtgagcttagcttagttggtaggggtattgcatattatatgcaggagccggg |
32144638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 40548300 - 40548357
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
40548300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
40548357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 52410314 - 52410257
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
52410314 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
52410257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 201 - 257
Target Start/End: Complemental strand, 44652056 - 44652000
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
44652056 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccg |
44652000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 204 - 259
Target Start/End: Complemental strand, 6920034 - 6919979
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
6920034 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
6919979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 255
Target Start/End: Original strand, 19550501 - 19550556
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
19550501 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
19550556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 255
Target Start/End: Original strand, 882385 - 882439
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
882385 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
882439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 255
Target Start/End: Original strand, 2522922 - 2522976
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
2522922 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaagagc |
2522976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 4139000 - 4139054
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
4139000 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
4139054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 9176656 - 9176602
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
9176656 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggg |
9176602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 15975148 - 15975206
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
15975148 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
15975206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 18194334 - 18194392
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
18194334 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggg |
18194392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 40192151 - 40192201
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40192151 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
40192201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 7269952 - 7270005
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
7269952 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
7270005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 10176976 - 10176919
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
10176976 |
atccccgtgaggttagctcagttggtagggatattgcatattatatgcaggagccggg |
10176919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 52974126 - 52974069
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
52974126 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggg |
52974069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 53347364 - 53347315
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53347364 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
53347315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 19999864 - 19999912
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19999864 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
19999912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 22502004 - 22501956
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22502004 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
22501956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 28550392 - 28550344
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28550392 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
28550344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 39966147 - 39966099
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
39966099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 52945892 - 52945940
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52945892 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
52945940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 208 - 259
Target Start/End: Complemental strand, 5636866 - 5636815
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
5636866 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
5636815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 196 - 255
Target Start/End: Complemental strand, 30555306 - 30555247
Alignment:
| Q |
196 |
agttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||| ||||| |||| |
|
|
| T |
30555306 |
agttttatccccgtgagcttagctcagttggtagggatattgcatattaaatgcaagagc |
30555247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 259
Target Start/End: Original strand, 50234123 - 50234178
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
50234123 |
ccccgtgagcttacctcagttggtagggatattgcatattatatgcaggagccggg |
50234178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 8964850 - 8964792
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||| ||||||| |||||||| |
|
|
| T |
8964850 |
tatccccgtgagtttagctcagttggtagggatattgcatatcatatgcaggagccggg |
8964792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 255
Target Start/End: Complemental strand, 10482927 - 10482873
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
10482927 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggagc |
10482873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 17218484 - 17218542
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
17218484 |
tatccccatgagcttagctcagttggtagggatattgcatattatatgcaagggccggg |
17218542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 25939005 - 25938955
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25939005 |
gtatccccgtgagtttagctcagttggtagggatattgcatattatatgca |
25938955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 28689746 - 28689688
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
28689746 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggagtcggg |
28689688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 32256628 - 32256570
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
32256628 |
tatccccgtgagcttagctcagttggtagggatattgcatgttatatgcaggggccggg |
32256570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 47098732 - 47098786
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
47098732 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
47098786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 48251568 - 48251626
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
48251568 |
tatccctgtgagcttagctcagttgatagggatattgcatattatatgcaggagccggg |
48251626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 53163591 - 53163637
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
53163637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 22472387 - 22472330
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
22472387 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgcaagagccggg |
22472330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 30779641 - 30779592
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30779641 |
tatcctcgtgagcttagctcagttggtagggatattgcatattatatgca |
30779592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 31529031 - 31528974
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||| ||| |||| |
|
|
| T |
31529031 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgcaggagtcggg |
31528974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 33225421 - 33225364
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| ||||||||| |||||||| |
|
|
| T |
33225421 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggg |
33225364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 33706800 - 33706743
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
33706800 |
atccccgtgagcttagctcaattggtagggatattacatattatatgcaagagccggg |
33706743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 34102684 - 34102627
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
34102684 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggggccggg |
34102627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 34898841 - 34898792
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
34898841 |
tatccccgtgagcttagttcagttggtagggatattgcatattatatgca |
34898792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 41936480 - 41936423
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
41936480 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
41936423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 46796002 - 46795945
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
46796002 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggg |
46795945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 48739818 - 48739769
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
48739818 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatgca |
48739769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 49447135 - 49447192
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
49447135 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgcaggagccggg |
49447192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 3748675 - 3748627
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
3748675 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgca |
3748627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 19996525 - 19996477
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19996525 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
19996477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 31586944 - 31586992
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31586944 |
atccccatgagcttagctcagttggtagggatattgcatattatatgca |
31586992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 50536905 - 50536857
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
50536905 |
atccccgtgagcttagctcagttggtagagatattgcatattatatgca |
50536857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 207 - 250
Target Start/End: Original strand, 8125641 - 8125684
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8125641 |
cgtgagcttagctcagttggtagggatattgcatattatatgca |
8125684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 259
Target Start/End: Original strand, 53577958 - 53578009
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||| |||||||| |
|
|
| T |
53577958 |
gtgagcttagctcagttggtagggatgttgcatattatatgcaagagccggg |
53578009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 3894544 - 3894598
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| |||||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
3894544 |
cccgtgagcttagttcagttggtatggatattgcatattatatgcaggagccggg |
3894598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 255
Target Start/End: Complemental strand, 5326106 - 5326056
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||| |||||||||| |
|
|
| T |
5326106 |
cccgtgagcttagctcagttggtagcgatattgcatattacatgcatgagc |
5326056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 11820001 - 11820047
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatg |
11820047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 255
Target Start/End: Original strand, 32828441 - 32828491
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
32828441 |
cccgtgagcttagctcggttggtagggatattgcatattatatgcaggagc |
32828491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 39719935 - 39719989
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
39719935 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcaggggccggg |
39719989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 49408771 - 49408829
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| |||||||||||||| ||| |||| |
|
|
| T |
49408771 |
tatccccgtgagcttagctcagctggtagggatatcgcatattatatgcaggagtcggg |
49408829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 6488120 - 6488169
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
6488120 |
tatccccatgagcttagctcaattggtagggatattgcatattatatgca |
6488169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 17602744 - 17602703
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17602744 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
17602703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 17608392 - 17608335
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
17608392 |
atccccgtgagcttaacttagttggtagggatattgcatattatatgcaggggccggg |
17608335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 250
Target Start/End: Original strand, 20489819 - 20489860
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatgca |
20489860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 26942753 - 26942798
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26942753 |
cccgtaagcttagctcagttggtagggatattgcatattatatgca |
26942798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 34847539 - 34847588
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
34847539 |
tatccccgtgagcttaattcagttggtagggatattgcatattatatgca |
34847588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 36625237 - 36625196
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatgca |
36625196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 37488533 - 37488476
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| ||||||||| | |||||| |
|
|
| T |
37488533 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccggg |
37488476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 44364017 - 44364066
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
44364017 |
tatccccgtgagtttaactcagttggtagggatattgcatattatatgca |
44364066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 2368933 - 2368981
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
2368933 |
atcctcgtgagcttagctcagttgttagggatattgcatattatatgca |
2368981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 211 - 255
Target Start/End: Complemental strand, 4640544 - 4640500
Alignment:
| Q |
211 |
agcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
4640544 |
agcttagctcagttggtagggatattgcatattatatgcaggagc |
4640500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 257
Target Start/End: Original strand, 31316630 - 31316686
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| ||||||||| || |||||| |
|
|
| T |
31316630 |
tatccccgtgagcttagctcagttgatagggatattgtatattatatacaagagccg |
31316686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 45871014 - 45871062
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
45871014 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgca |
45871062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 53752773 - 53752725
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
53752773 |
atccccgtgagcttaactcagttggtagggatatggcatattatatgca |
53752725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 54769899 - 54769855
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
54769899 |
ccgtgagcttagcttagttggtagggatattgcatattatatgca |
54769855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 11250659 - 11250616
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11250659 |
cgtgaacttagctcagttggtagggatattgcatattatatgca |
11250616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 48546173 - 48546216
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
48546173 |
cccgtgagcttagctcagttggtagtgatattgcatattatatg |
48546216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 49750474 - 49750431
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
49750474 |
cgtgagcttagctcagttgatagggatattgcatattatatgca |
49750431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 259
Target Start/End: Complemental strand, 52309181 - 52309126
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| |||||||| ||| |||| |
|
|
| T |
52309181 |
ccccgtgagcttaactcagttggtagggatattgcatactatatgcaggagtcggg |
52309126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 52670223 - 52670180
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
52670223 |
cccgtgagcttagttcagttggtagggatattgcatattatatg |
52670180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 13638318 - 13638272
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
13638318 |
atccccgtgagcttagttcagttggtagggatattacatattatatg |
13638272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 29373519 - 29373465
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| ||||||||||| || |||||||||||||||||| | |||||| |
|
|
| T |
29373519 |
cccgtgagcttaactcagttggtaaggatattgcatattatatgcaggggccggg |
29373465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 45551882 - 45551836
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
45551882 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
45551836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 247
Target Start/End: Complemental strand, 52046455 - 52046413
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
52046455 |
cccgtgagcttagctcagttggtagggatattgcattttatat |
52046413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 52984013 - 52984055
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
52984013 |
gtgagcttagctcagttggtagggatattgcatattgtatgca |
52984055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 53432811 - 53432753
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
53432811 |
tatccctgtgagtttaactcagttggtagggatattgcatattatatgcaggggccggg |
53432753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 54021401 - 54021359
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
54021401 |
gtgagcttagctcagttggtatggatattgcatattatatgca |
54021359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 255
Target Start/End: Complemental strand, 2390427 - 2390374
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
2390427 |
atccccgtaagcgtagctcagttgatagggatattgcatattatatgcaggagc |
2390374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 4541898 - 4541943
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
4541898 |
cccgtgagcttagttcagttggtagggatattgtatattatatgca |
4541943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 4860161 - 4860206
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
4860161 |
cccgtgagcttagctcagttggtacggatattgcattttatatgca |
4860206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 4880169 - 4880214
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
4880169 |
cccgtgagcttagctcagttggtacggatattgcattttatatgca |
4880214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 24430146 - 24430191
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
24430146 |
cccgtgagcttagctcagttggtagagatattgtatattatatgca |
24430191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 28193794 - 28193843
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
28193794 |
tatccccttgagcttaactcagttggtagggatattgcattttatatgca |
28193843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 31922353 - 31922410
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
31922353 |
atccccgtgagcttgtctcagttggtaagaatattgcatattatatgcaggagccggg |
31922410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 34740289 - 34740334
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatg |
252 |
Q |
| |
|
|||||| ||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
34740289 |
cgtgagtttagcccagttggtagggatattgcatattatatgcatg |
34740334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 242
Target Start/End: Original strand, 34757529 - 34757566
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatat |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34757529 |
cccgtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 44685241 - 44685196
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
44685241 |
atccccgtgagcttagcttagttggtagagatattgcatattatat |
44685196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 8762153 - 8762105
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||| ||||||||||||| |
|
|
| T |
8762153 |
atccccgtgagcttaacttagttggtagggatattacatattatatgca |
8762105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 242
Target Start/End: Original strand, 10349402 - 10349442
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatat |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
10349402 |
atccccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 11436501 - 11436549
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
11436501 |
atcctcgtgaacttaactcagttggtagggatattgcatattatatgca |
11436549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 246
Target Start/End: Original strand, 39300381 - 39300425
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
39300381 |
atccccgtgagcttagctcagttggtagggatattacattttata |
39300425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 42108243 - 42108207
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42108243 |
ttagctcagttggtagggatattgcatattatatgca |
42108207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 12894600 - 12894557
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
12894600 |
cccgtgagcttaactcagttggtagggatattgcattttatatg |
12894557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 29559740 - 29559701
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatg |
29559701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 259
Target Start/End: Complemental strand, 31673316 - 31673265
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||||||||| |||||||| |
|
|
| T |
31673316 |
gtgagcttgtctcagttggtaaggatattgcatattatatgcaggagccggg |
31673265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 36763427 - 36763474
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
36763427 |
tccccgtgagcttggctcagttggtagggacattgcataatatatgca |
36763474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 40723733 - 40723686
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
||||||| ||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
40723733 |
atccccgagagcttaactcagttggtagggatattgcatgttatatgc |
40723686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 45198719 - 45198766
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
45198719 |
tatctccgttagcttagttcagttggtagggatattgcatattatatg |
45198766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 250
Target Start/End: Original strand, 46879999 - 46880042
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
46879999 |
cgtgagcttagctcagttgatagggatattgcattttatatgca |
46880042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 52575461 - 52575508
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
52575461 |
tccccgtgagcttagctcagttggtacgaatattgcattttatatgca |
52575508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 53207965 - 53208012
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||| |||||||| |
|
|
| T |
53207965 |
tccccgtgagcttagctcagttggtaagggcaatgcataatatatgca |
53208012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 552174 - 552216
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
552174 |
gtgagcttaactcagttggtagggatattgcataatatatgca |
552216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 1743870 - 1743824
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||| ||||||| |
|
|
| T |
1743870 |
atccccgtgagcttaactcaattggtagggatattgcattttatatg |
1743824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 2007157 - 2007099
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
2007157 |
tatccccgtgaacttaactcagttggtagaaatattgcatattatatgcaggagtcggg |
2007099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 4200652 - 4200610
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
4200652 |
gtgaacttaactcagttggtagggatattgcatattatatgca |
4200610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 16895304 - 16895258
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
16895304 |
tatccccgagagcttaactcagttggtaggaatattgcatattatat |
16895258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 19591653 - 19591595
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| ||||||||||||||||| || | |||||||||||||||| | |||||||| |
|
|
| T |
19591653 |
tatccccttgagcttagctcagttgataagtatattgcatattatatgtaggagccggg |
19591595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 25279132 - 25279086
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
25279132 |
atcctcgtgagcttagcttagttggtagggatattgtatattatatg |
25279086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 260
Target Start/End: Original strand, 25833824 - 25833878
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||||| |||| |||| |
|
|
| T |
25833824 |
ccgttagcttagctcagttggtaaagatattgcatattatatgcaggagcggggt |
25833878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 211 - 250
Target Start/End: Complemental strand, 40910246 - 40910205
Alignment:
| Q |
211 |
agcttagctcagttggtagggg--tattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40910246 |
agcttagctcagttggtagggggatattgcatattatatgca |
40910205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 45513069 - 45513023
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||| |||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
45513069 |
tatccccgtaagcttagctcagttagtatggatattgcatattatat |
45513023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 51425836 - 51425894
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||| ||||||||| | |||||| |
|
|
| T |
51425836 |
tatccccgtgagcttaactcagttggtagggatatcacattttatatgcaggggccggg |
51425894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 51772892 - 51772934
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
51772892 |
gtgagcttaacttagttggtagggatattgcatattatatgca |
51772934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 11234439 - 11234492
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||| |||| | ||||| || ||||||||| |||| |
|
|
| T |
11234439 |
atccccgtgagcttagctcagttagtagagatattgtattttatatgcaggagc |
11234492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 15299068 - 15299117
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
15299068 |
tatctccgtgagtttagttcagttggtagggatattgtatattatatgca |
15299117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 28396848 - 28396807
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
28396848 |
tgagcttaactcagttggtagggatattgcatgttatatgca |
28396807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 29098688 - 29098737
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||| |||||||||||| | ||||| |||||||||||| |
|
|
| T |
29098688 |
tatccccgtgaacttaactcagttggtagagatattgtatattatatgca |
29098737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Original strand, 37112814 - 37112855
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
37112814 |
tgagcttagctcagttggtaaggatattgcattttatatgca |
37112855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 38819397 - 38819348
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||| ||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
38819397 |
tatccccatgaacttagcttagttggtagggatatttcatattatatgca |
38819348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 40963785 - 40963736
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||||||| || || |||||||| ||||||||| |
|
|
| T |
40963785 |
tatccccgtgagcttaactcagttgataaggatattgcattttatatgca |
40963736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 44945735 - 44945686
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
44945735 |
tatctccgtgagcttatctcagttggtaggaatattgcgtattatatgca |
44945686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 50675811 - 50675770
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
50675811 |
ccgtgagtttatctcagttggtagggatattgcatattatat |
50675770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 20887838 - 20887794
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
20887838 |
ccgtgagtttagctcagttggtagggatattgcataatttatgca |
20887794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 259
Target Start/End: Original strand, 24303388 - 24303444
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||| | |||||| | |||||| |
|
|
| T |
24303388 |
tccccgtgagcttagctcagttggcagggacattgcataatttatgcaggggccggg |
24303444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 36666458 - 36666506
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||| |||||||||||| |
|
|
| T |
36666458 |
atccccgtgagcttagttcagttggcaggaatattgtatattatatgca |
36666506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 259
Target Start/End: Original strand, 45118638 - 45118694
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| |||||||| | |||||| |
|
|
| T |
45118638 |
tccccatgagcttagctcagttggtagggacattgcattatatatgcaggggccggg |
45118694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 46730842 - 46730798
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
46730842 |
ccgtgagcttagctcagttgataggcatatagcatattatatgca |
46730798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 247
Target Start/End: Complemental strand, 51266578 - 51266534
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
51266578 |
tcccggtgagcttagctcagttggtaagggtaatgcataatatat |
51266534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 51467173 - 51467221
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||| |||| ||||||||| |
|
|
| T |
51467173 |
atccccgtgaacttagctcagttgatagggatatcgcattttatatgca |
51467221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 252
Target Start/End: Complemental strand, 55066661 - 55066617
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatg |
252 |
Q |
| |
|
||||||||||||||||||||| || || |||||| |||||||||| |
|
|
| T |
55066661 |
gtgagcttagctcagttggtacggataatgcataatatatgcatg |
55066617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 202 - 258
Target Start/End: Original strand, 8963 - 9019
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
8963 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgg |
9019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 115)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 201 - 257
Target Start/End: Original strand, 3446726 - 3446782
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
3446726 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccg |
3446782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 199 - 259
Target Start/End: Complemental strand, 33229009 - 33228949
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
33229009 |
tgtatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
33228949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 201 - 260
Target Start/End: Original strand, 6331558 - 6331617
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccgggt |
260 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
6331558 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagccgggt |
6331617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 2643693 - 2643751
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
2643693 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggg |
2643751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 4562826 - 4562768
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
4562826 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggg |
4562768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 8250375 - 8250317
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
8250375 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
8250317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 255
Target Start/End: Original strand, 19281604 - 19281658
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
19281604 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
19281658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 22653718 - 22653660
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
22653718 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
22653660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 255
Target Start/End: Complemental strand, 25857369 - 25857315
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
25857369 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
25857315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 39408764 - 39408706
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
39408764 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgcaagagccggg |
39408706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 4183173 - 4183230
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
4183173 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
4183230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 18278490 - 18278433
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
18278490 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggg |
18278433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 18694781 - 18694830
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18694781 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
18694830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 19684070 - 19684123
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
19684070 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
19684123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 206 - 259
Target Start/End: Original strand, 41509517 - 41509570
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
41509570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 44948592 - 44948641
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44948592 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
44948641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 199 - 259
Target Start/End: Complemental strand, 30932522 - 30932462
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
30932522 |
tgtatccccgtgagcttacctcagttggtagggatattgcatattatatgcaggaggcggg |
30932462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 38400307 - 38400355
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38400307 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgca |
38400355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 204 - 259
Target Start/End: Original strand, 34613978 - 34614033
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
34613978 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
34614033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 1071466 - 1071524
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| |||||||||||| |||||||| |
|
|
| T |
1071466 |
tatccccgtgagcttagctcagttggtatggatattgtatattatatgcaggagccggg |
1071524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 3438944 - 3439002
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
3438944 |
tatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggg |
3439002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 5474902 - 5474960
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||| ||| |||||||| |
|
|
| T |
5474902 |
tatccccgtgagcttagctcagttggcagggatattgcatattatacgcaggagccggg |
5474960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 17034731 - 17034789
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
17034731 |
tatccccgtgagcttagctcaattggtagggatattgcatattatatgcaggagtcggg |
17034789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 17078453 - 17078511
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||| ||| |||| |
|
|
| T |
17078453 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggagtcggg |
17078511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 18803207 - 18803265
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||| |
|
|
| T |
18803207 |
tatccccgtgagcttagctcacttggtaggaatattgcatattatatgcaagagccggg |
18803265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 40535523 - 40535465
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||| | |||||| |
|
|
| T |
40535523 |
tatccccgtgagcttagctcagttggtacggatattgcatattatatgcaggggccggg |
40535465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 44822419 - 44822477
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||||| |||||||| |
|
|
| T |
44822419 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggg |
44822477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 1844814 - 1844871
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
1844814 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
1844871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 2289606 - 2289655
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2289606 |
tatccccgtgagcttagctcagttggtaggaatattgcatattatatgca |
2289655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 5521294 - 5521245
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
5521294 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgca |
5521245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 11050831 - 11050782
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
11050831 |
tatccccgtgagcttagctcagttggtagggatattacatattatatgca |
11050782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 20296415 - 20296472
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||| || || |||||||||||||||||| |||||||| |
|
|
| T |
20296415 |
atccccgtgagcttagctcagttgataaggatattgcatattatatgcaggagccggg |
20296472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 27297172 - 27297225
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
27297172 |
atccccgtgagcttagctcagttggtagggatattgcatattgtatgcaggagc |
27297225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 33233295 - 33233238
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
33233295 |
atccccgtgagcttatctcagttggtagggatattgcatattatatgcaggagtcggg |
33233238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 15233410 - 15233458
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
15233410 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgca |
15233458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 15485658 - 15485706
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
15485658 |
tatccccgtgagcttagctcagttggtaaggatattgcatattatatgc |
15485706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 15764927 - 15764975
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15764927 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgca |
15764975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 28195207 - 28195159
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28195207 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgca |
28195159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 207 - 255
Target Start/End: Original strand, 36182644 - 36182692
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
36182692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 44857307 - 44857259
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44857307 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgca |
44857259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 41566760 - 41566807
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41566760 |
tccccgtgagcttagctcagttggtaggaatattgcatattatatgca |
41566807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 466680 - 466622
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||| ||||||||||||| ||| |||| |
|
|
| T |
466680 |
tatccccgtgagcatagctcagttggtagggatattacatattatatgcaagagtcggg |
466622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 1260182 - 1260228
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
1260182 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatg |
1260228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 6636034 - 6635992
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcatattatatgca |
6635992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 30390439 - 30390385
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
30390439 |
cccgtgaatttagctcagttggtagggatattgcatattatatgcaggagccggg |
30390385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 32609261 - 32609203
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
32609261 |
tatctccgtgagcttaactcagttggtagggatattgcatattatatgcaagagtcggg |
32609203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 36005438 - 36005496
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||| || |||| ||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
36005438 |
tatccccgtgagcgtaactcaattggtagggatattgcatattatatgcaggagccggg |
36005496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 3287129 - 3287072
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| ||||||||||||||||||| |||| |||||||||||||||||| | |||||| |
|
|
| T |
3287129 |
atccctgtgagcttagctcagttggaagggatattgcatattatatgcaggggccggg |
3287072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 5062294 - 5062339
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
5062294 |
atccccgtgagcttaactcagttggtagggatattgcatattatat |
5062339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 27497602 - 27497553
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
27497602 |
tatccccgtgagcatagctcagttggtagggatattgcatgttatatgca |
27497553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 27913539 - 27913494
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
27913539 |
cccgtgagcttagctcaattggtagggatattgcatattatatgca |
27913494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 33041937 - 33041888
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
33041937 |
tatccccgtgagtttaactcagttggtagggatattgcatattatatgca |
33041888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 7379673 - 7379625
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
7379673 |
atccccgtgagcttaactcagttggtaaggatattgcatattatatgca |
7379625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 17487705 - 17487749
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17487705 |
ccgtgaacttagctcagttggtagggatattgcatattatatgca |
17487749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 28194629 - 28194677
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
28194629 |
atccccatgagcttagctcagttgctagggatattgcatattatatgca |
28194677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 38525626 - 38525578
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
38525626 |
atccccgtgagcttagctcagttggtaaggatattgcattttatatgca |
38525578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 2806571 - 2806528
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
2806571 |
cccgtgagcttagctcagttggtagggatattgtatattatatg |
2806528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 259
Target Start/End: Original strand, 5612957 - 5613008
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| | |||||| |
|
|
| T |
5612957 |
gtgagcttagctcagttggcagggatattgcatattatatgcaagggccggg |
5613008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 19612715 - 19612758
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
19612715 |
cccgtgagcttagttcagttggtagggatattgcatattatatg |
19612758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 23405194 - 23405241
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
23405194 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgca |
23405241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 27449183 - 27449230
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatg |
252 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
27449183 |
cccgtgagcatagctcagttggtagggatattgcattttatatgcatg |
27449230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 30392898 - 30392859
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatg |
30392859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 33669732 - 33669779
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| |||||||||||||||| |
|
|
| T |
33669732 |
tatccccgtgagcttaactcagttagtagggatattgcatattatatg |
33669779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 209 - 247
Target Start/End: Original strand, 8322810 - 8322848
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8322810 |
tgagcttagttcagttggtaggggtattgcatattatat |
8322848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 28153217 - 28153167
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
28153217 |
gtatcccagtgagcttaactcagttggtagggatattgcatgttatatgca |
28153167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 255
Target Start/End: Complemental strand, 33549128 - 33549074
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||||||||||||| ||| | ||||| |||||||||||| |||| |
|
|
| T |
33549128 |
tatccccgtgagcttagctcagttgatagagatattgtatattatatgcaggagc |
33549074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 40363140 - 40363098
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
40363140 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
40363098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 44658329 - 44658375
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
44658329 |
ccccgtgagcttagctcagttagtaggaatattgcatattatatgca |
44658375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 20898123 - 20898078
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
20898123 |
cccgtgaacttaactcagttggtaggggtattgcatattttatgca |
20898078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 255
Target Start/End: Complemental strand, 22718134 - 22718081
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
||||||||||||||| |||||||||||||| || || |||||||||||| |||| |
|
|
| T |
22718134 |
atccccgtgagcttaactcagttggtagggatactgtatattatatgcaggagc |
22718081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 209 - 250
Target Start/End: Original strand, 31223624 - 31223665
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatattatatgca |
31223665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 35798100 - 35798051
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||||||| ||| | |||||||||||||||||| |
|
|
| T |
35798100 |
tatccccgtgagcttaactcagttgttagagatattgcatattatatgca |
35798051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 38179319 - 38179270
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| ||||| |||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
38179319 |
tatccctgtgagtttagctcagttggtagggatattgcattttatatgca |
38179270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 38557297 - 38557248
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||| ||||||||| |
|
|
| T |
38557297 |
tatccccgtgagcttaactcagttggtagggatatggcattttatatgca |
38557248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 43895910 - 43895967
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||| ||||||||| | |||||| |
|
|
| T |
43895910 |
atccccgtgagcttagctcagttggtagggatatcacattttatatgcaagggccggg |
43895967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 43936697 - 43936746
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
43936697 |
tatctccgtgagcttagctcagttggtagggatatcgcattttatatgca |
43936746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 250
Target Start/End: Original strand, 1500970 - 1501006
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1500970 |
ttagctcagttggtagggatattgcatattatatgca |
1501006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 7281757 - 7281713
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| | |||||||||||||||| |||||||||||||||||| |
|
|
| T |
7281757 |
ccgtgagttaagctcagttggtagggatattgcatattatatgca |
7281713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 32168931 - 32168971
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
32168931 |
gtgagcttaactcagttggtagggatattgcatattatatg |
32168971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 40864401 - 40864453
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
40864401 |
cgtgagcttagctcagttggtaggaatattgcattttatatgcaggggccggg |
40864453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 7907617 - 7907570
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| | | ||||||||| |||||||||||||||| |
|
|
| T |
7907617 |
tatccccgtgagcttagtttaattggtagggatattgcatattatatg |
7907570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 8742894 - 8742851
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
8742894 |
cccgtgagcttagctcagttggtagagatattacatattatatg |
8742851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 44021069 - 44021116
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||| |
|
|
| T |
44021069 |
gtatccccgtgagcttaactcagttggtaggaatattgcatgttatat |
44021116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 3301811 - 3301853
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
3301811 |
cccgtgagcttagctcatttggtagggatattgcattttatat |
3301853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 241
Target Start/End: Original strand, 19958097 - 19958135
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19958097 |
tccccgtgagcttagctcagttggtagggacattgcata |
19958135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 241
Target Start/End: Original strand, 20919608 - 20919646
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20919608 |
tccccgtgagcttagctcagttggtagggacattgcata |
20919646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 27016273 - 27016319
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||| |||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
27016273 |
tatcaccgtgagcttagttcagttggtatggatattgcatattatat |
27016319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 29449444 - 29449502
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||| ||| ||||||||| | |||||| |
|
|
| T |
29449444 |
tatccccatgagcttagctcagttggtagggatatcacattttatatgcaggggccggg |
29449502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 29772347 - 29772305
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
29772347 |
ccgtgagcttaacacagttggtagggatattgcatattatatg |
29772305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 29942193 - 29942151
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
29942193 |
gtgagcttaactcagttagtagggatattgcatattatatgca |
29942151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Original strand, 37063523 - 37063565
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
37063523 |
gtgatcttacctcagttggtagggatattgcatattatatgca |
37063565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 37352560 - 37352518
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
37352560 |
gtgagtttaactcagttggtagggatattgcatattatatgca |
37352518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 41286132 - 41286174
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
41286132 |
ccgtgagcttggttcagttggtagggatattgcatattatatg |
41286174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 241
Target Start/End: Original strand, 43214354 - 43214392
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
43214354 |
tccccgtgagcttaactcagttggtagggatattgcata |
43214392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 44898557 - 44898507
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||| |||||| ||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
44898557 |
gtatcctcgtgaggttaactcagttggtaggaatattgcatattatatgca |
44898507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 8763379 - 8763424
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||| |||||| |
|
|
| T |
8763379 |
atccccgtgagcttagctcaattcgtagggatattgcattttatat |
8763424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 9330571 - 9330526
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||||||| ||| | |||||||||||||||||| |
|
|
| T |
9330571 |
cccgtgagcttaactcagttgatagagatattgcatattatatgca |
9330526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 16040237 - 16040286
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| |||||||| |||| |||| |
|
|
| T |
16040237 |
tatcctcgtgagcttagttcagttggtagggatattgcatgttatttgca |
16040286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 16385108 - 16385067
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
16385108 |
tgagcttagctcagttggtatggatattgcattttatatgca |
16385067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 17601075 - 17601124
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||| |||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
17601075 |
tatctccgtgaacttaactcagttggtagggatattgcatatcatatgca |
17601124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 250
Target Start/End: Original strand, 22589903 - 22589944
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
22589903 |
tgagcttatcttagttggtagggatattgcatattatatgca |
22589944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 25932532 - 25932581
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||| ||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
25932532 |
tatcaccgtgaacttagctcagttggtagggatattgtatattaaatgca |
25932581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 33816490 - 33816441
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||| || ||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
33816490 |
tatccccgtcagtttacctcagttggtagagatattgcatattatatgca |
33816441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 43146348 - 43146397
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||||||| | |||||| |
|
|
| T |
43146348 |
tatccccgtgagtttaactcagttggtagggatattgcataatttatgca |
43146397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 5398180 - 5398132
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| |||| ||||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
5398180 |
atccctgtgaacttagctcagttggtagggatattacattttatatgca |
5398132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Complemental strand, 10463270 - 10463242
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10463270 |
tccccgtgagcttagctcagttggtaggg |
10463242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 245
Target Start/End: Complemental strand, 11144288 - 11144244
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
11144288 |
tatccccgtgagtttagctcagttggtagaaatattgcatattat |
11144244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 20435775 - 20435823
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggt-aggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||| ||||| |||| ||||||||||| |||||| |
|
|
| T |
20435775 |
tccccgtgagcttagctcacttggtaagggatattgcatattttatgca |
20435823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 23919544 - 23919504
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23919544 |
gtgagcttagctcagttggtagggacattgcataatatatg |
23919504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 33222221 - 33222181
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
33222221 |
gtgaacttaactcagttggtagggatattgcatattatatg |
33222181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 33262439 - 33262487
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| ||||||||| |||||||| ||| |||| ||||||||| |
|
|
| T |
33262439 |
atccccgtgagtttagctcagctggtagggatatcgcattttatatgca |
33262487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 33563282 - 33563234
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||| || ||||||||| |
|
|
| T |
33563282 |
atccccgtgaacttaactcagttggtagggatattgtattttatatgca |
33563234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 211 - 259
Target Start/End: Original strand, 34355727 - 34355775
Alignment:
| Q |
211 |
agcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| |||||||||||||||| ||||| |||||||||||| | |||||| |
|
|
| T |
34355727 |
agctcagctcagttggtagggatattgtatattatatgcaggggccggg |
34355775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 40473623 - 40473575
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| ||||||||| |
|
|
| T |
40473623 |
atccccgtgagcttaactcagttggtagaaatattgcatgttatatgca |
40473575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 40688712 - 40688664
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| ||||| ||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
40688712 |
atcctcgtgatcttagctcagttggtagagatattgcattttatatgca |
40688664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 205 - 259
Target Start/End: Complemental strand, 930 - 876
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
930 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggg |
876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 4087 - 4030
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
4087 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggg |
4030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 255
Target Start/End: Original strand, 17617 - 17670
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
17670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 250
Target Start/End: Original strand, 46522 - 46571
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46522 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgca |
46571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 11990 - 12048
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
11990 |
tatcctcgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggg |
12048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 259
Target Start/End: Complemental strand, 10899 - 10842
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
10899 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggg |
10842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 205 - 254
Target Start/End: Complemental strand, 12331 - 12282
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgag |
254 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12331 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcatgag |
12282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 201 - 257
Target Start/End: Original strand, 112104 - 112160
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccg |
257 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
112104 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccg |
112160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 37488 - 37430
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
37488 |
tatcctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggg |
37430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 23361 - 23406
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
23361 |
cccgtgaacttaactcagttggtagggatattgcatattatatgca |
23406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 8899 - 8841
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||| | |||||| |
|
|
| T |
8899 |
tatccccgtgagcttagctcagttggtagggatattgcatattttatgcaggggccggg |
8841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 12456 - 12513
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
12456 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggaggcggg |
12513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 250
Target Start/End: Complemental strand, 13266 - 13228
Alignment:
| Q |
212 |
gcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13266 |
gcttagctcagttggtagggatattgcatattatatgca |
13228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 2446 - 2398
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2446 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgca |
2398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 8818 - 8866
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
8818 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgca |
8866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 245
Target Start/End: Original strand, 45881 - 45924
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 21263 - 21309
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
21263 |
ccccgtgagcttagcttagttggtagggatattgcatattatatgca |
21309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 3666 - 3711
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
3666 |
cccgtgagcttaactcagttggtagggatattgcatattatatgca |
3711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 11181 - 11136
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
11181 |
ttagctcagttggtagggatattgcatattatatgcaggagccggg |
11136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 21509 - 21464
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
21509 |
ttagctcagttggtagggatattgcatattatatgcaggagccggg |
21464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 15761 - 15809
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
15761 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatgca |
15809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 65854 - 65814
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
65854 |
gtgagcttagctcagttggtagggatattgcatattatatg |
65814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Original strand, 396 - 454
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||| |||||||||||||||||| | |||||| |
|
|
| T |
396 |
tatccccgtgaacttagctcaattgatagggatattgcatattatatgcaggggccggg |
454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 250
Target Start/End: Original strand, 1871 - 1909
Alignment:
| Q |
212 |
gcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattatatgca |
1909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 28004 - 27946
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
||||| |||||||||||||| |||||||||| |||||||| ||||||||| | |||||| |
|
|
| T |
28004 |
tatcctcgtgagcttagctcggttggtagggatattgcattttatatgcaggggccggg |
27946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 3660 - 3619
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgc |
249 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
3660 |
gtgagcttagctcagttggtagggatatttcatattatatgc |
3619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 5981 - 6025
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
5981 |
ccccgtgagcttagctcatttgatagggatattgcatattatatg |
6025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 201 - 245
Target Start/End: Complemental strand, 236429 - 236385
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
236429 |
tatccccgtgagattagttcagttggtagggatattgcatattat |
236385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 315646 - 315694
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
315646 |
atccccgtgaacttagctcagttggtaaggatattgcattttatatgca |
315694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 259
Target Start/End: Original strand, 41904 - 41959
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||| | |||||||||||| |||| |
|
|
| T |
41904 |
ccccatgagcttagctcagttggtagcggcattgcaaaatatatgcatgagtcggg |
41959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 50071 - 50028
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
50071 |
cccgtgagcttaactcagttgatagggatattgcatattatatg |
50028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 259
Target Start/End: Original strand, 175 - 225
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||| | |||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatgcaggggccggg |
225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 259
Target Start/End: Complemental strand, 146 - 96
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||| | |||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatgcaggggccggg |
96 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 6769 - 6811
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
6769 |
ccgtgaacttaactcagttggtagggatattgcatattatatg |
6811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 56323 - 56377
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgcatgagccggg |
259 |
Q |
| |
|
|||||||||||| |||| |||| |||| |||||||||||||||||| | |||||| |
|
|
| T |
56323 |
cccgtgagcttaactcaattggcagggatattgcatattatatgcaggggccggg |
56377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 1262 - 1307
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
1262 |
cccgtgagcttaactcagttggtaggaatattgtatattatatgca |
1307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 1317 - 1362
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
1317 |
cccgtgagcttaactcagttggtaggaatattgtatattatatgca |
1362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 59252 - 59203
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||| || |||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
59252 |
tatcctcgcgagcttagttcagttggtagagatattgcatattatatgca |
59203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0555 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0555
Description:
Target: scaffold0555; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Original strand, 9309 - 9337
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9309 |
tccccgtgagcttagctcagttggtaggg |
9337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 15006 - 15050
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | |||||| |
|
|
| T |
15006 |
ccgtgagcttagctcagttggtagggacattgcataatttatgca |
15050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 250
Target Start/End: Original strand, 510965 - 511001
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatgca |
250 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
510965 |
ttagctcagttagtagggatattgcatattatatgca |
511001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University