View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_low_36 (Length: 276)
Name: NF2086_low_36
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 24 - 154
Target Start/End: Original strand, 6624693 - 6624823
Alignment:
| Q |
24 |
ggattcggacttgaatcagattcgatttctcaccccagattcgatttctctccacaaataataacagcaactacacagtcgaatttcgaatttttgcaac |
123 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6624693 |
ggattcggacttgaattggattcgatttctcaccccagattcgatttctctccacaaataacaacagcaattacacagtcgaatttcgaatttttgcaat |
6624792 |
T |
 |
| Q |
124 |
gagaaagcaacaacagaaacgaaattcaaat |
154 |
Q |
| |
|
||||||| ||||||| |||||||||||||| |
|
|
| T |
6624793 |
gagaaagtaacaacaacaacgaaattcaaat |
6624823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 158 - 251
Target Start/End: Complemental strand, 13865651 - 13865558
Alignment:
| Q |
158 |
tgcacgaatttgggacatattttgggtatgaacaatacacaaatttttgcttttgataatgaatagtaccgaaaatgggttgtttgtgtgttgt |
251 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13865651 |
tgcacgaatttgggacatattcttggtatgaacaatacacaaatttttgcttttgataatgaatagtaccgaaaatgggttgtttgtgtgttgt |
13865558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 13865546 - 13865514
Alignment:
| Q |
228 |
gaaaatgggttgtttgtgtgttgtagttgattg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13865546 |
gaaaatgggttgtttgtgtgttgtagttgattg |
13865514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 37086148 - 37086180
Alignment:
| Q |
228 |
gaaaatgggttgtttgtgtgttgtagttgattg |
260 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
37086148 |
gaaaatgggttgtttgtgtgttgttgttgattg |
37086180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University