View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_low_46 (Length: 237)
Name: NF2086_low_46
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 52037139 - 52037343
Alignment:
| Q |
1 |
attttgaatgaattttaccaaaatttttgcgaaaagttatgtaggaaatggagtgtcatagtagacaactcggttgataaattgaatgagtactaatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52037139 |
attttgaatgaattttaccaaaatttttgcgaaaagttatgtaggaaatggagtctcatagtagacaactcggttgataaattgaatgagtactaatcaa |
52037238 |
T |
|
| Q |
101 |
agaannnnnnnnnnnnnngaaggaagtactaatcaaagatataaagttcaaaataataaccttaacataatcactagtactttcttaccaactaaaattt |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52037239 |
aga----ttttttttttttaaggaagtactaatcaaagatataaagttcaaaataataaccttaacataatcattagtactttcttaccaactaaaattt |
52037334 |
T |
|
| Q |
201 |
ccctataag |
209 |
Q |
| |
|
|||| |||| |
|
|
| T |
52037335 |
ccctgtaag |
52037343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University