View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_low_48 (Length: 234)
Name: NF2086_low_48
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 15 - 101
Target Start/End: Complemental strand, 20836722 - 20836636
Alignment:
| Q |
15 |
ttgtcatgattttagttttccccaatgcaacactgtgaatcttctgttttatttcaaggagatctaaaagaagttgttcttgtaaag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20836722 |
ttgtcatgattttagttttccccaatgcaatactgtgaatcttctgttttatttcaaggagatctaaaagaagttgttcttgtaaag |
20836636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 15 - 101
Target Start/End: Complemental strand, 20810367 - 20810281
Alignment:
| Q |
15 |
ttgtcatgattttagttttccccaatgcaacactgtgaatcttctgttttatttcaaggagatctaaaagaagttgttcttgtaaag |
101 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
20810367 |
ttgtcatgattttatttttccccaatgcaacaccatgaatcttctgctttatttcaaagagatctaaaagaagttgtttttgtaaag |
20810281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 100
Target Start/End: Complemental strand, 31174093 - 31174026
Alignment:
| Q |
33 |
tccccaatgcaacactgtgaatcttctgttttatttcaaggagatctaaaagaagttgttcttgtaaa |
100 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
31174093 |
tccccaatgcaatgctatgaatctcttgttttatttgcaggagatctaaaagaagttgttgttgtaaa |
31174026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University