View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2086_low_50 (Length: 227)
Name: NF2086_low_50
Description: NF2086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2086_low_50 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 45103549 - 45103776
Alignment:
| Q |
1 |
cattttcttctgatggagcaaacatgggaaaattggcctcttcattcggtaataacactagctacacatataattatttctcataagttatactttatgn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103549 |
cattttcttctgatggagcaaacatgggaaaattggcctcttcattcggtaataacactagctacacatataattatttctcataagttatactttatgt |
45103648 |
T |
 |
| Q |
101 |
nnnnnnataaatcgtaaatcattatgatcaac-nnnnnnnnntgttatgtatcatttatattttctcataaaccttgttttaactttttaactaactgtc |
199 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103649 |
ttttttataaatcctaaatcattatgatcaacaaaaaaaaaatgttatgtatcatttatattttctcataaaccttgttttaactttttaactaactgtc |
45103748 |
T |
 |
| Q |
200 |
attattacaataggaaatggttgatgta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45103749 |
attattacaataggaaatggttgatgta |
45103776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University